Incidental Mutation 'R7114:Aatk'
ID551697
Institutional Source Beutler Lab
Gene Symbol Aatk
Ensembl Gene ENSMUSG00000025375
Gene Nameapoptosis-associated tyrosine kinase
SynonymsAATYK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120007313-120047167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120009619 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1291 (A1291T)
Ref Sequence ENSEMBL: ENSMUSP00000067181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026436] [ENSMUST00000064307] [ENSMUST00000103019] [ENSMUST00000103020] [ENSMUST00000106233]
Predicted Effect probably benign
Transcript: ENSMUST00000026436
SMART Domains Protein: ENSMUSP00000026436
Gene: ENSMUSG00000025372

DomainStartEndE-ValueType
Pfam:IMD 17 237 6e-101 PFAM
PDB:4JS0|B 261 292 2e-13 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064307
AA Change: A1291T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067181
Gene: ENSMUSG00000025375
AA Change: A1291T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 49 N/A INTRINSIC
Pfam:Pkinase_Tyr 135 405 3.9e-63 PFAM
Pfam:Pkinase 136 404 2.6e-33 PFAM
low complexity region 425 457 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 615 624 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
low complexity region 808 819 N/A INTRINSIC
low complexity region 913 927 N/A INTRINSIC
low complexity region 934 943 N/A INTRINSIC
low complexity region 985 1004 N/A INTRINSIC
low complexity region 1063 1082 N/A INTRINSIC
low complexity region 1085 1096 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
low complexity region 1179 1204 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103019
AA Change: A1234T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099308
Gene: ENSMUSG00000025375
AA Change: A1234T

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103020
AA Change: A1234T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099309
Gene: ENSMUSG00000025375
AA Change: A1234T

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106233
SMART Domains Protein: ENSMUSP00000101840
Gene: ENSMUSG00000025372

DomainStartEndE-ValueType
Pfam:IMD 17 237 1.6e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased brain size, longer axons and fewer neurites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Aatk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Aatk APN 11 120010186 missense probably benign 0.02
IGL00953:Aatk APN 11 120011221 missense probably benign 0.00
IGL01019:Aatk APN 11 120012275 missense probably benign
IGL01758:Aatk APN 11 120010819 missense possibly damaging 0.86
IGL02377:Aatk APN 11 120046863 utr 5 prime probably benign
IGL02902:Aatk APN 11 120011777 missense probably benign 0.00
IGL03067:Aatk APN 11 120010083 missense probably benign 0.00
IGL03116:Aatk APN 11 120016751 missense probably benign 0.14
IGL03279:Aatk APN 11 120013678 missense probably damaging 1.00
IGL03405:Aatk APN 11 120016403 missense probably benign 0.02
PIT4366001:Aatk UTSW 11 120010960 missense possibly damaging 0.55
PIT4802001:Aatk UTSW 11 120011346 missense probably benign
R0101:Aatk UTSW 11 120010913 missense probably benign 0.19
R0497:Aatk UTSW 11 120018780 missense probably damaging 0.99
R0535:Aatk UTSW 11 120010193 missense probably benign 0.00
R0638:Aatk UTSW 11 120009922 missense probably damaging 1.00
R0939:Aatk UTSW 11 120012143 missense probably damaging 0.99
R1475:Aatk UTSW 11 120010888 missense probably damaging 0.96
R1840:Aatk UTSW 11 120013732 missense probably damaging 1.00
R1865:Aatk UTSW 11 120010222 missense probably benign 0.00
R1982:Aatk UTSW 11 120013514 missense probably damaging 1.00
R2027:Aatk UTSW 11 120009317 missense probably damaging 1.00
R2115:Aatk UTSW 11 120009736 missense probably benign
R2220:Aatk UTSW 11 120012177 missense probably damaging 1.00
R2264:Aatk UTSW 11 120010274 missense probably damaging 1.00
R2504:Aatk UTSW 11 120018855 missense probably benign 0.00
R3872:Aatk UTSW 11 120010219 missense possibly damaging 0.71
R4551:Aatk UTSW 11 120011569 missense probably benign 0.03
R4657:Aatk UTSW 11 120013478 missense possibly damaging 0.69
R4744:Aatk UTSW 11 120016122 missense possibly damaging 0.64
R4924:Aatk UTSW 11 120011525 missense probably damaging 1.00
R5063:Aatk UTSW 11 120010489 missense probably benign 0.07
R5223:Aatk UTSW 11 120013452 missense possibly damaging 0.95
R5243:Aatk UTSW 11 120016768 missense probably damaging 1.00
R5376:Aatk UTSW 11 120012034 missense probably damaging 0.98
R5442:Aatk UTSW 11 120018768 missense probably benign 0.02
R5550:Aatk UTSW 11 120009303 missense probably benign 0.42
R5678:Aatk UTSW 11 120010154 missense probably benign 0.00
R5932:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6026:Aatk UTSW 11 120012364 missense possibly damaging 0.65
R6129:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6409:Aatk UTSW 11 120011732 missense probably benign 0.01
R6477:Aatk UTSW 11 120018870 missense probably benign 0.00
R6478:Aatk UTSW 11 120010991 missense probably benign 0.00
R6749:Aatk UTSW 11 120010774 missense possibly damaging 0.58
R6753:Aatk UTSW 11 120010151 missense probably benign
R6787:Aatk UTSW 11 120010682 missense probably damaging 1.00
R6852:Aatk UTSW 11 120010468 missense probably benign 0.10
X0064:Aatk UTSW 11 120011176 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGTCACCAAAGCAGCCTTG -3'
(R):5'- TTGGGTATACACAGAGCTGGG -3'

Sequencing Primer
(F):5'- GGCACCAACGGGAAATCAC -3'
(R):5'- CACAGAGCTGGGGGAGGTTG -3'
Posted On2019-05-15