Incidental Mutation 'R7115:Rassf5'
ID551712
Institutional Source Beutler Lab
Gene Symbol Rassf5
Ensembl Gene ENSMUSG00000026430
Gene NameRas association (RalGDS/AF-6) domain family member 5
SynonymsNore1A, Nore1B, Rapl, 1300019G20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131176410-131245258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131181249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 293 (V293A)
Ref Sequence ENSEMBL: ENSMUSP00000027688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027688] [ENSMUST00000068564] [ENSMUST00000068791] [ENSMUST00000112442] [ENSMUST00000131855] [ENSMUST00000151874] [ENSMUST00000212202]
PDB Structure
Solution structure of the C1 domain of Nore1, a novel Ras effector [SOLUTION NMR]
C1 domain of Nore1 [SOLUTION NMR]
Structure of the murine Nore1-Sarah domain [X-RAY DIFFRACTION]
Crystal Structure of NORE1A in Complex with RAS [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027688
AA Change: V293A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027688
Gene: ENSMUSG00000026430
AA Change: V293A

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
RA 267 359 1.07e-22 SMART
Pfam:Nore1-SARAH 366 405 1.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000068564
AA Change: V145A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067011
Gene: ENSMUSG00000026430
AA Change: V145A

DomainStartEndE-ValueType
RA 119 211 1.07e-22 SMART
PDB:4LGD|H 212 260 5e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000068791
SMART Domains Protein: ENSMUSP00000067461
Gene: ENSMUSG00000026427

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112442
SMART Domains Protein: ENSMUSP00000108061
Gene: ENSMUSG00000026430

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
PDB:3DDC|B 198 301 7e-62 PDB
Blast:RA 267 294 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131855
SMART Domains Protein: ENSMUSP00000137678
Gene: ENSMUSG00000026427

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 554 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151874
SMART Domains Protein: ENSMUSP00000138061
Gene: ENSMUSG00000026427

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 556 1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212202
AA Change: V193A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele have defects in lymphocyte homing to lymphoid tissues, B cell maturation and dendritic cell function, and display lymphocyte hyperproliferation leading to lupus glomerulonephritis and lymphomas. Homozygotes for another null allele are resistant to TNF-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Rassf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Rassf5 APN 1 131180599 missense probably damaging 0.96
IGL03055:Rassf5 UTSW 1 131244995 missense probably benign 0.00
R0464:Rassf5 UTSW 1 131212261 missense probably benign 0.00
R0589:Rassf5 UTSW 1 131244983 missense probably damaging 0.99
R0634:Rassf5 UTSW 1 131244956 missense probably damaging 0.99
R0639:Rassf5 UTSW 1 131245066 missense probably damaging 1.00
R0727:Rassf5 UTSW 1 131181265 missense probably damaging 1.00
R1926:Rassf5 UTSW 1 131212339 missense probably damaging 1.00
R2310:Rassf5 UTSW 1 131244740 missense probably damaging 1.00
R5354:Rassf5 UTSW 1 131180648 missense probably benign 0.00
R5422:Rassf5 UTSW 1 131181174 missense possibly damaging 0.87
R5490:Rassf5 UTSW 1 131181195 missense possibly damaging 0.95
R6189:Rassf5 UTSW 1 131244979 missense probably damaging 1.00
R6328:Rassf5 UTSW 1 131180668 missense probably damaging 1.00
R6531:Rassf5 UTSW 1 131244814 missense possibly damaging 0.93
R6759:Rassf5 UTSW 1 131182251 missense probably benign 0.08
R7350:Rassf5 UTSW 1 131178536 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TTCCCACCCAGGACTGATAG -3'
(R):5'- AGACAGAATCAGCAGTGCC -3'

Sequencing Primer
(F):5'- CACCCAGGACTGATAGTGAGGTTTAG -3'
(R):5'- CTACACAGGTTTCATCAAAGTGC -3'
Posted On2019-05-15