Incidental Mutation 'R7115:Csn1s2a'
ID551718
Institutional Source Beutler Lab
Gene Symbol Csn1s2a
Ensembl Gene ENSMUSG00000061937
Gene Namecasein alpha s2-like A
SynonymsCsn1s2a, Csng
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location87774567-87788797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87781805 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 96 (C96R)
Ref Sequence ENSEMBL: ENSMUSP00000075716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076379] [ENSMUST00000196585] [ENSMUST00000196749] [ENSMUST00000200322]
Predicted Effect probably benign
Transcript: ENSMUST00000076379
AA Change: C96R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000075716
Gene: ENSMUSG00000061937
AA Change: C96R

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 58 86 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196585
AA Change: C81R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143515
Gene: ENSMUSG00000061937
AA Change: C81R

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196749
AA Change: C95R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143715
Gene: ENSMUSG00000061937
AA Change: C95R

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 57 85 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200322
AA Change: C88R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142901
Gene: ENSMUSG00000061937
AA Change: C88R

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Csn1s2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Csn1s2a APN 5 87784580 missense possibly damaging 0.83
IGL01829:Csn1s2a APN 5 87786710 missense unknown
R0137:Csn1s2a UTSW 5 87778967 missense possibly damaging 0.46
R1503:Csn1s2a UTSW 5 87775799 missense possibly damaging 0.66
R1799:Csn1s2a UTSW 5 87778193 missense probably damaging 0.97
R1870:Csn1s2a UTSW 5 87778199 missense probably benign 0.27
R2400:Csn1s2a UTSW 5 87780155 critical splice donor site probably null
R2897:Csn1s2a UTSW 5 87781821 missense unknown
R4034:Csn1s2a UTSW 5 87781887 missense probably benign 0.27
R4360:Csn1s2a UTSW 5 87781841 missense possibly damaging 0.46
R4377:Csn1s2a UTSW 5 87775821 missense probably benign
R4834:Csn1s2a UTSW 5 87781778 missense probably benign 0.27
R4965:Csn1s2a UTSW 5 87781838 missense possibly damaging 0.83
R6807:Csn1s2a UTSW 5 87781872 missense probably benign
R7353:Csn1s2a UTSW 5 87785302 missense possibly damaging 0.66
R7420:Csn1s2a UTSW 5 87780006 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGGTCCTAAATTAATGCCATCTGC -3'
(R):5'- ACACATGAATGGTTTTGCGTG -3'

Sequencing Primer
(F):5'- CTAAAATCCCCTTTAATGCATTGC -3'
(R):5'- CACATGAATGGTTTTGCGTGATTTAC -3'
Posted On2019-05-15