Incidental Mutation 'R7115:Trim56'
ID551719
Institutional Source Beutler Lab
Gene Symbol Trim56
Ensembl Gene ENSMUSG00000043279
Gene Nametripartite motif-containing 56
SynonymsRNF109, A130009K11Rik, LOC384309
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137105644-137116209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137113660 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 334 (Q334L)
Ref Sequence ENSEMBL: ENSMUSP00000058109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054384] [ENSMUST00000152207]
Predicted Effect probably damaging
Transcript: ENSMUST00000054384
AA Change: Q334L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058109
Gene: ENSMUSG00000043279
AA Change: Q334L

DomainStartEndE-ValueType
RING 21 59 9.09e-8 SMART
low complexity region 118 133 N/A INTRINSIC
Pfam:zf-B_box 164 205 1.9e-7 PFAM
coiled coil region 257 291 N/A INTRINSIC
low complexity region 302 309 N/A INTRINSIC
low complexity region 381 399 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152207
SMART Domains Protein: ENSMUSP00000117874
Gene: ENSMUSG00000043279

DomainStartEndE-ValueType
RING 21 59 9.09e-8 SMART
low complexity region 118 133 N/A INTRINSIC
Pfam:zf-B_box 164 205 2.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Trim56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Trim56 APN 5 137114500 missense possibly damaging 0.95
IGL02604:Trim56 APN 5 137113076 missense probably damaging 0.98
IGL02653:Trim56 APN 5 137112906 missense probably damaging 1.00
IGL03069:Trim56 APN 5 137113762 missense probably damaging 0.99
R0711:Trim56 UTSW 5 137112992 missense probably benign 0.00
R1167:Trim56 UTSW 5 137112520 missense probably damaging 0.98
R1470:Trim56 UTSW 5 137113163 missense probably damaging 0.99
R1470:Trim56 UTSW 5 137113163 missense probably damaging 0.99
R1508:Trim56 UTSW 5 137113937 missense probably benign 0.00
R1791:Trim56 UTSW 5 137114398 missense probably damaging 1.00
R2484:Trim56 UTSW 5 137112674 missense possibly damaging 0.95
R4274:Trim56 UTSW 5 137113687 missense probably damaging 1.00
R4579:Trim56 UTSW 5 137114064 missense possibly damaging 0.60
R4766:Trim56 UTSW 5 137112725 missense probably benign 0.07
R4932:Trim56 UTSW 5 137114489 missense probably damaging 1.00
R5117:Trim56 UTSW 5 137113978 missense probably benign 0.13
R6444:Trim56 UTSW 5 137112616 missense probably damaging 0.99
R6747:Trim56 UTSW 5 137114521 missense probably damaging 1.00
R6962:Trim56 UTSW 5 137112647 missense probably damaging 0.97
R7266:Trim56 UTSW 5 137114243 missense probably damaging 0.98
X0019:Trim56 UTSW 5 137114210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCTTTCGATGAAGACCC -3'
(R):5'- AGGAAGTGCTGGGACAACTC -3'

Sequencing Primer
(F):5'- GAAGACCCCATCATCTTCTTGG -3'
(R):5'- ACAACTCCGGGCCCTTGTG -3'
Posted On2019-05-15