Incidental Mutation 'R7115:Map2k1'
ID551731
Institutional Source Beutler Lab
Gene Symbol Map2k1
Ensembl Gene ENSMUSG00000004936
Gene Namemitogen-activated protein kinase kinase 1
SynonymsMek1, MAP kinase kinase 1, Prkmk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64185770-64253631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64212606 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 139 (I139T)
Ref Sequence ENSEMBL: ENSMUSP00000005066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005066]
Predicted Effect probably damaging
Transcript: ENSMUST00000005066
AA Change: I139T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005066
Gene: ENSMUSG00000004936
AA Change: I139T

DomainStartEndE-ValueType
low complexity region 30 51 N/A INTRINSIC
S_TKc 68 361 4.44e-80 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein kinase lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, this kinase is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced embryo size and midgestational lethality due to impaired development and hypovascularization of the placenta with decreased labyrinth cell proliferation and enhanced cell apoptosis. Mutant MEFs fail to exhibit fibronectin-induced migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Map2k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Map2k1 APN 9 64193808 missense probably benign 0.39
mystic_falls UTSW 9 64191266 critical splice donor site probably null
R0366:Map2k1 UTSW 9 64193702 splice site probably null
R4285:Map2k1 UTSW 9 64212643 missense probably damaging 0.99
R5254:Map2k1 UTSW 9 64187745 unclassified probably benign
R5261:Map2k1 UTSW 9 64191561 missense probably damaging 1.00
R5741:Map2k1 UTSW 9 64214601 missense possibly damaging 0.89
R5742:Map2k1 UTSW 9 64193771 missense probably damaging 0.99
R5865:Map2k1 UTSW 9 64191266 critical splice donor site probably null
R6212:Map2k1 UTSW 9 64205163 missense probably damaging 1.00
R6299:Map2k1 UTSW 9 64214490 missense possibly damaging 0.52
R6460:Map2k1 UTSW 9 64187295 missense probably damaging 0.97
R6843:Map2k1 UTSW 9 64187691 missense probably damaging 0.99
R7028:Map2k1 UTSW 9 64193823 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GCCCACTGAGAATTCCTGGC -3'
(R):5'- AGAAAGACATTCTTCTTTACTCCAC -3'

Sequencing Primer
(F):5'- GAAGCAATGCTGTCATCCTG -3'
(R):5'- ACTCCACTTCTTAAAAGCTTTCCC -3'
Posted On2019-05-15