Incidental Mutation 'R7115:Eomes'
ID551733
Institutional Source Beutler Lab
Gene Symbol Eomes
Ensembl Gene ENSMUSG00000032446
Gene Nameeomesodermin
SynonymsTbr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location118478212-118486132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118484489 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 534 (N534S)
Ref Sequence ENSEMBL: ENSMUSP00000035020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035020] [ENSMUST00000111763] [ENSMUST00000150633]
Predicted Effect probably benign
Transcript: ENSMUST00000035020
AA Change: N534S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035020
Gene: ENSMUSG00000032446
AA Change: N534S

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 7.3e-120 SMART
Pfam:T-box_assoc 484 705 1.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111763
AA Change: N515S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107393
Gene: ENSMUSG00000032446
AA Change: N515S

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 5.53e-120 SMART
Blast:TBOX 485 511 6e-8 BLAST
low complexity region 648 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150633
SMART Domains Protein: ENSMUSP00000118079
Gene: ENSMUSG00000032446

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 60 67 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
TBOX 201 395 8.01e-117 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to implant, and lack trophoectoderm outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Eomes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Eomes APN 9 118482266 missense probably damaging 1.00
IGL01322:Eomes APN 9 118484830 missense probably benign 0.14
IGL01532:Eomes APN 9 118482249 missense probably damaging 1.00
R0088:Eomes UTSW 9 118478673 missense probably damaging 0.99
R0305:Eomes UTSW 9 118484757 missense probably benign 0.11
R0894:Eomes UTSW 9 118482300 splice site probably null
R1110:Eomes UTSW 9 118484599 missense probably benign 0.29
R1326:Eomes UTSW 9 118484497 nonsense probably null
R1942:Eomes UTSW 9 118484648 missense probably benign 0.01
R2108:Eomes UTSW 9 118478852 missense probably benign 0.09
R2237:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2238:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2239:Eomes UTSW 9 118482291 missense probably damaging 1.00
R3915:Eomes UTSW 9 118481273 missense probably benign 0.01
R4158:Eomes UTSW 9 118478963 missense probably benign
R5274:Eomes UTSW 9 118480529 missense probably damaging 1.00
R6894:Eomes UTSW 9 118481285 missense probably damaging 1.00
R7055:Eomes UTSW 9 118480499 missense possibly damaging 0.57
X0021:Eomes UTSW 9 118482258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTAACTCCATCTCCCACG -3'
(R):5'- CTTCCTCTGATAAGCGCCAC -3'

Sequencing Primer
(F):5'- GGATTCCCCTAGATCCCATCAGATTG -3'
(R):5'- TGCCATAGCAGGGAAGGTC -3'
Posted On2019-05-15