Incidental Mutation 'R7115:Spice1'
ID551743
Institutional Source Beutler Lab
Gene Symbol Spice1
Ensembl Gene ENSMUSG00000043065
Gene Namespindle and centriole associated protein 1
SynonymsCcdc52, D16Ertd480e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44347121-44388497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44379275 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 697 (G697R)
Ref Sequence ENSEMBL: ENSMUSP00000058832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050897]
Predicted Effect probably benign
Transcript: ENSMUST00000050897
AA Change: G697R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058832
Gene: ENSMUSG00000043065
AA Change: G697R

DomainStartEndE-ValueType
Pfam:SPICE 33 436 1.4e-151 PFAM
low complexity region 627 642 N/A INTRINSIC
coiled coil region 729 757 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 804 824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Spice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Spice1 APN 16 44366630 missense probably benign 0.20
IGL01688:Spice1 APN 16 44384710 missense probably benign 0.04
IGL03259:Spice1 APN 16 44356167 missense probably damaging 1.00
IGL03367:Spice1 APN 16 44356178 missense probably damaging 0.99
R0230:Spice1 UTSW 16 44365576 splice site probably benign
R0944:Spice1 UTSW 16 44384761 missense probably benign
R1352:Spice1 UTSW 16 44386822 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1894:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1907:Spice1 UTSW 16 44357830 nonsense probably null
R2404:Spice1 UTSW 16 44366626 missense probably benign 0.29
R2444:Spice1 UTSW 16 44366568 nonsense probably null
R3551:Spice1 UTSW 16 44357869 missense probably damaging 0.96
R3848:Spice1 UTSW 16 44378891 nonsense probably null
R3857:Spice1 UTSW 16 44355443 missense probably damaging 1.00
R4490:Spice1 UTSW 16 44382113 missense probably damaging 1.00
R5593:Spice1 UTSW 16 44370752 missense possibly damaging 0.50
R5996:Spice1 UTSW 16 44384674 missense probably benign 0.00
R6303:Spice1 UTSW 16 44370697 missense probably benign 0.03
R6552:Spice1 UTSW 16 44379033 missense possibly damaging 0.75
R7042:Spice1 UTSW 16 44385680 missense probably benign 0.04
R7062:Spice1 UTSW 16 44357896 missense probably damaging 1.00
R7065:Spice1 UTSW 16 44355535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAAGAAACCCCGTGTTG -3'
(R):5'- TTTGTCTAACCTAAGGGCCAG -3'

Sequencing Primer
(F):5'- AAACCCCGTGTTGTCAGAG -3'
(R):5'- TTCTGACACAGGGAGTCTGAAACC -3'
Posted On2019-05-15