Incidental Mutation 'R7115:Ctif'
ID551746
Institutional Source Beutler Lab
Gene Symbol Ctif
Ensembl Gene ENSMUSG00000052928
Gene NameCBP80/20-dependent translation initiation factor
SynonymsLOC269037, Gm672
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7115 (G1)
Quality Score132.491
Status Not validated
Chromosome18
Chromosomal Location75431224-75697696 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC to CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC at 75471803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165559]
Predicted Effect probably benign
Transcript: ENSMUST00000165559
SMART Domains Protein: ENSMUSP00000129974
Gene: ENSMUSG00000052928

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
MIF4G 401 602 5.46e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CTIF is a component of the CBP80 (NCBP1; MIM 600469)/CBP20 (NCBP2; MIM 605133) translation initiation complex that binds cotranscriptionally to the cap end of nascent mRNA. The CBP80/CBP20 complex is involved in a simultaneous editing and translation step that recognizes premature termination codons (PTCs) in mRNAs and directs PTC-containing mRNAs toward nonsense-mediated decay (NMD). On mRNAs without PTCs, the CBP80/CBP20 complex is replaced with cytoplasmic mRNA cap-binding proteins, including EIF4G (MIM 600495), and steady-state translation of the mRNAs resumes in the cytoplasm (Kim et al., 2009 [PubMed 19648179]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Ctif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ctif APN 18 75437176 missense possibly damaging 0.95
IGL01481:Ctif APN 18 75611784 splice site probably benign
IGL02299:Ctif APN 18 75637245 missense probably damaging 1.00
IGL02319:Ctif APN 18 75521873 splice site probably benign
IGL03130:Ctif APN 18 75521618 missense probably benign
R0304:Ctif UTSW 18 75521818 missense probably benign 0.09
R0730:Ctif UTSW 18 75565012 missense probably damaging 0.99
R0835:Ctif UTSW 18 75435336 missense probably damaging 1.00
R1226:Ctif UTSW 18 75521579 small deletion probably benign
R1302:Ctif UTSW 18 75521678 missense probably benign 0.22
R1549:Ctif UTSW 18 75565025 missense probably damaging 1.00
R1674:Ctif UTSW 18 75637180 missense probably benign 0.00
R1697:Ctif UTSW 18 75624305 splice site probably benign
R1848:Ctif UTSW 18 75519941 missense probably damaging 0.96
R2102:Ctif UTSW 18 75521381 missense probably benign
R3499:Ctif UTSW 18 75611757 missense possibly damaging 0.94
R3878:Ctif UTSW 18 75519977 missense probably damaging 0.96
R4157:Ctif UTSW 18 75435270 missense probably benign 0.42
R4168:Ctif UTSW 18 75637215 missense probably damaging 1.00
R4225:Ctif UTSW 18 75435237 missense probably benign 0.01
R4560:Ctif UTSW 18 75519881 missense probably damaging 1.00
R4822:Ctif UTSW 18 75521561 missense probably benign 0.01
R5176:Ctif UTSW 18 75637219 missense probably damaging 1.00
R5824:Ctif UTSW 18 75610678 missense possibly damaging 0.55
R6824:Ctif UTSW 18 75521711 missense probably damaging 1.00
R6934:Ctif UTSW 18 75435360 missense probably benign 0.07
R7014:Ctif UTSW 18 75437208 missense possibly damaging 0.82
R7169:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7187:Ctif UTSW 18 75637219 missense probably damaging 1.00
R7355:Ctif UTSW 18 75610685 missense probably damaging 0.98
R7402:Ctif UTSW 18 75611736 missense probably benign 0.18
R7451:Ctif UTSW 18 75519803 missense possibly damaging 0.82
X0027:Ctif UTSW 18 75637263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTATTTCTTAAGGCATGGGGAAG -3'
(R):5'- CCTCCACAGAAGGACTTCACTG -3'

Sequencing Primer
(F):5'- CTTAAGGCATGGGGAAGTCATTC -3'
(R):5'- AAGGACTTCACTGTGCGG -3'
Posted On2019-05-15