Incidental Mutation 'R7116:Plag1'
ID551756
Institutional Source Beutler Lab
Gene Symbol Plag1
Ensembl Gene ENSMUSG00000003282
Gene Namepleiomorphic adenoma gene 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location3900996-3938423 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 3904812 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 126 (C126*)
Ref Sequence ENSEMBL: ENSMUSP00000003369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003369] [ENSMUST00000137439] [ENSMUST00000151543]
Predicted Effect probably null
Transcript: ENSMUST00000003369
AA Change: C126*
SMART Domains Protein: ENSMUSP00000003369
Gene: ENSMUSG00000003282
AA Change: C126*

DomainStartEndE-ValueType
ZnF_C2H2 34 56 2.2e-2 SMART
ZnF_C2H2 62 86 1.6e-4 SMART
ZnF_C2H2 92 114 1.89e-1 SMART
ZnF_C2H2 121 143 5.99e-4 SMART
ZnF_C2H2 150 172 2.86e-1 SMART
ZnF_C2H2 185 207 1.03e-2 SMART
ZnF_C2H2 213 236 8.94e-3 SMART
low complexity region 364 379 N/A INTRINSIC
low complexity region 396 411 N/A INTRINSIC
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137439
Predicted Effect probably benign
Transcript: ENSMUST00000151543
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pleomorphic adenoma gene 1 encodes a zinc finger protein with 2 putative nuclear localization signals. PLAG1, which is developmentally regulated, has been shown to be consistently rearranged in pleomorphic adenomas of the salivary glands. PLAG1 is activated by the reciprocal chromosomal translocations involving 8q12 in a subset of salivary gland pleomorphic adenomas. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced male fertility, small seminal vesicles and ventral prostate, reduced litter size (females only), reduced embryonic and postnatal growth, and delayed eyelid opening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Plag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Plag1 APN 4 3904055 missense probably damaging 0.99
IGL01775:Plag1 APN 4 3904513 missense probably damaging 1.00
IGL02738:Plag1 APN 4 3903812 nonsense probably null
scrawny UTSW 4 3905463 nonsense probably null
PIT4378001:Plag1 UTSW 4 3905492 missense probably benign 0.16
R0217:Plag1 UTSW 4 3904379 missense probably benign 0.05
R0359:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0554:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0892:Plag1 UTSW 4 3904532 nonsense probably null
R1541:Plag1 UTSW 4 3904085 missense probably benign
R1964:Plag1 UTSW 4 3903956 missense probably benign
R2011:Plag1 UTSW 4 3904889 missense probably damaging 1.00
R2012:Plag1 UTSW 4 3904870 missense probably damaging 1.00
R2126:Plag1 UTSW 4 3904169 missense possibly damaging 0.50
R3982:Plag1 UTSW 4 3904055 missense probably damaging 0.97
R4285:Plag1 UTSW 4 3905654 missense probably benign 0.13
R5244:Plag1 UTSW 4 3903887 missense probably benign 0.02
R5289:Plag1 UTSW 4 3905545 missense probably damaging 1.00
R5386:Plag1 UTSW 4 3904075 missense probably benign
R5428:Plag1 UTSW 4 3905538 missense possibly damaging 0.94
R5608:Plag1 UTSW 4 3905463 nonsense probably null
R5755:Plag1 UTSW 4 3904492 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6080:Plag1 UTSW 4 3903815 missense probably benign
R6296:Plag1 UTSW 4 3904499 missense probably damaging 1.00
R7038:Plag1 UTSW 4 3904676 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTACCACCATGTGTCTCC -3'
(R):5'- GTGCTAAGATAATCACTCACTCAC -3'

Sequencing Primer
(F):5'- CATCCTTCCGGGTGTAGAAC -3'
(R):5'- TCACCGGAAAGACCATCT -3'
Posted On2019-05-15