Incidental Mutation 'R7116:Coro1c'
ID551761
Institutional Source Beutler Lab
Gene Symbol Coro1c
Ensembl Gene ENSMUSG00000004530
Gene Namecoronin, actin binding protein 1C
Synonymscoronin 3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location113842436-113908758 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 113852206 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 138 (W138*)
Ref Sequence ENSEMBL: ENSMUSP00000004646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004646] [ENSMUST00000164980]
Predicted Effect probably null
Transcript: ENSMUST00000004646
AA Change: W138*
SMART Domains Protein: ENSMUSP00000004646
Gene: ENSMUSG00000004530
AA Change: W138*

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
WD40 119 159 1.09e-5 SMART
WD40 162 202 3.09e-5 SMART
DUF1900 256 390 4.5e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164980
AA Change: W138*
SMART Domains Protein: ENSMUSP00000129314
Gene: ENSMUSG00000004530
AA Change: W138*

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
Pfam:WD40 120 149 8e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Coro1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Coro1c APN 5 113849614 missense probably benign 0.07
IGL01138:Coro1c APN 5 113852161 splice site probably benign
IGL01474:Coro1c APN 5 113882155 splice site probably benign
IGL02075:Coro1c APN 5 113844393 missense probably damaging 1.00
IGL02106:Coro1c APN 5 113852273 missense probably benign 0.01
IGL02831:Coro1c APN 5 113844408 missense probably benign
R0254:Coro1c UTSW 5 113845252 missense probably benign 0.09
R0975:Coro1c UTSW 5 113882121 missense probably damaging 1.00
R1835:Coro1c UTSW 5 113848543 missense probably benign 0.10
R2944:Coro1c UTSW 5 113850800 missense probably damaging 1.00
R5210:Coro1c UTSW 5 113845306 missense probably damaging 1.00
R5354:Coro1c UTSW 5 113846165 missense possibly damaging 0.94
R5379:Coro1c UTSW 5 113845382 missense probably damaging 1.00
R5414:Coro1c UTSW 5 113848546 missense possibly damaging 0.55
R5869:Coro1c UTSW 5 113850846 intron probably benign
R5891:Coro1c UTSW 5 113850811 missense probably damaging 0.98
R7037:Coro1c UTSW 5 113845396 missense possibly damaging 0.60
X0018:Coro1c UTSW 5 113848594 missense probably benign 0.13
Z1088:Coro1c UTSW 5 113850649 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTTTGCCAGCAGGACAG -3'
(R):5'- TTAAATCAGGCACACAGTCGTCAC -3'

Sequencing Primer
(F):5'- TTGCCAGCAGGACAGTGTGG -3'
(R):5'- AGTCGTCACCTGCGCCTTAG -3'
Posted On2019-05-15