Incidental Mutation 'R7116:Vmn2r37'
ID551766
Institutional Source Beutler Lab
Gene Symbol Vmn2r37
Ensembl Gene ENSMUSG00000066828
Gene Namevomeronasal 2, receptor 37
SynonymsV2r14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location9205546-9223653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9217899 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 322 (T322A)
Ref Sequence ENSEMBL: ENSMUSP00000072566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072787]
Predicted Effect probably benign
Transcript: ENSMUST00000072787
AA Change: T322A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072566
Gene: ENSMUSG00000066828
AA Change: T322A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 157 469 2.9e-26 PFAM
Pfam:NCD3G 512 563 1.1e-16 PFAM
Pfam:7tm_3 550 783 1.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Vmn2r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vmn2r37 APN 7 9206681 missense probably benign 0.05
IGL01909:Vmn2r37 APN 7 9216033 nonsense probably null
IGL02281:Vmn2r37 APN 7 9217882 missense possibly damaging 0.95
IGL02282:Vmn2r37 APN 7 9206762 missense probably benign 0.19
IGL02513:Vmn2r37 APN 7 9217935 missense probably benign 0.14
R0136:Vmn2r37 UTSW 7 9217783 nonsense probably null
R2051:Vmn2r37 UTSW 7 9217793 missense probably damaging 1.00
R2262:Vmn2r37 UTSW 7 9217944 missense probably damaging 0.99
R3158:Vmn2r37 UTSW 7 9217714 missense probably benign 0.03
R4084:Vmn2r37 UTSW 7 9215985 missense probably benign
R4114:Vmn2r37 UTSW 7 9210093 critical splice acceptor site probably null
R5231:Vmn2r37 UTSW 7 9206595 missense possibly damaging 0.94
R5462:Vmn2r37 UTSW 7 9217974 missense probably damaging 1.00
R6437:Vmn2r37 UTSW 7 9217851 missense probably damaging 0.98
R7104:Vmn2r37 UTSW 7 9216046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCCATTAGCCAATCAAATGAG -3'
(R):5'- GCTTTGCCTTTGTGAAAATGATCTC -3'

Sequencing Primer
(F):5'- TAGCCAATCAAATGAGGCATTAGATG -3'
(R):5'- ACCAAATTGTGATGTCATCCAC -3'
Posted On2019-05-15