Incidental Mutation 'R7116:Kcnj1'
ID551781
Institutional Source Beutler Lab
Gene Symbol Kcnj1
Ensembl Gene ENSMUSG00000041248
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 1
SynonymsKir1.1, ROMK, ROMK-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location32372493-32399197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32396981 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 234 (T234A)
Ref Sequence ENSEMBL: ENSMUSP00000131625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047334] [ENSMUST00000172015] [ENSMUST00000213393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047334
AA Change: T214A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046793
Gene: ENSMUSG00000041248
AA Change: T214A

DomainStartEndE-ValueType
Pfam:IRK 24 361 1.4e-155 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172015
AA Change: T234A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131625
Gene: ENSMUSG00000041248
AA Change: T234A

DomainStartEndE-ValueType
Pfam:IRK 44 373 7.6e-144 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213393
AA Change: T214A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null mutation die before weaning with impaired electrolyte, acid-base, and fluid-volume homeostasis, reduced NaCl absorption in the thick ascending limb, and abnormal tubuloglomerular feedback. A colony of mutants with extended suvival serves as a model for Bartter's syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Kcnj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Kcnj1 APN 9 32396498 missense probably benign 0.01
IGL02958:Kcnj1 APN 9 32396555 missense probably damaging 1.00
IGL03285:Kcnj1 APN 9 32396861 missense possibly damaging 0.67
R1179:Kcnj1 UTSW 9 32396766 missense probably damaging 0.96
R1503:Kcnj1 UTSW 9 32396492 missense probably damaging 0.98
R1918:Kcnj1 UTSW 9 32396738 missense probably benign 0.00
R4439:Kcnj1 UTSW 9 32394118 intron probably benign
R4659:Kcnj1 UTSW 9 32394148 missense probably benign
R4661:Kcnj1 UTSW 9 32396622 missense probably benign 0.14
R4917:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R4918:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R5385:Kcnj1 UTSW 9 32396723 missense probably damaging 1.00
R6017:Kcnj1 UTSW 9 32394104 intron probably benign
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6117:Kcnj1 UTSW 9 32397182 missense probably damaging 1.00
R6245:Kcnj1 UTSW 9 32396867 missense probably damaging 1.00
R6316:Kcnj1 UTSW 9 32397336 missense probably damaging 0.96
R6585:Kcnj1 UTSW 9 32397261 missense probably benign
R6988:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTGTGGTGCCATATTAGCCAAG -3'
(R):5'- AGGTTGCACTGGTGGATTCTAC -3'

Sequencing Primer
(F):5'- GTGGTGCCATATTAGCCAAGATCTC -3'
(R):5'- AACCAACTCGAAGTCCTGTTGGG -3'
Posted On2019-05-15