Incidental Mutation 'R7116:Lamb2'
ID551783
Institutional Source Beutler Lab
Gene Symbol Lamb2
Ensembl Gene ENSMUSG00000052911
Gene Namelaminin, beta 2
SynonymsLams, npht, Lamb-2
Accession Numbers

Genbank: NM_008483; MGI: 99916

Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108479736-108490530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108487323 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1121 (F1121L)
Ref Sequence ENSEMBL: ENSMUSP00000069087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably benign
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065014
AA Change: F1121L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911
AA Change: F1121L

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085044
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166103
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178075
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193678
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 2138070
Lethality: D1-D30
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Lamb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lamb2 APN 9 108487733 unclassified probably null
IGL02072:Lamb2 APN 9 108481908 nonsense probably null
IGL02079:Lamb2 APN 9 108482113 missense probably damaging 1.00
IGL02087:Lamb2 APN 9 108487119 missense possibly damaging 0.95
IGL02193:Lamb2 APN 9 108489360 missense probably benign 0.00
IGL02199:Lamb2 APN 9 108480625 missense possibly damaging 0.49
IGL02201:Lamb2 APN 9 108487542 missense probably damaging 1.00
IGL02468:Lamb2 APN 9 108487149 missense probably damaging 1.00
F6893:Lamb2 UTSW 9 108482556 missense probably benign 0.12
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0122:Lamb2 UTSW 9 108486514 missense probably benign 0.01
R0452:Lamb2 UTSW 9 108486354 unclassified probably benign
R0524:Lamb2 UTSW 9 108484372 missense possibly damaging 0.90
R0605:Lamb2 UTSW 9 108486105 unclassified probably benign
R0737:Lamb2 UTSW 9 108483794 missense probably benign 0.03
R1083:Lamb2 UTSW 9 108483693 missense probably benign
R1159:Lamb2 UTSW 9 108481408 missense probably damaging 1.00
R1283:Lamb2 UTSW 9 108481808 missense possibly damaging 0.46
R1507:Lamb2 UTSW 9 108490382 missense probably damaging 1.00
R1547:Lamb2 UTSW 9 108482625 missense probably benign 0.00
R1576:Lamb2 UTSW 9 108480307 missense probably damaging 0.96
R1647:Lamb2 UTSW 9 108481423 critical splice donor site probably null
R1678:Lamb2 UTSW 9 108483686 critical splice acceptor site probably null
R1740:Lamb2 UTSW 9 108481928 missense probably damaging 1.00
R1803:Lamb2 UTSW 9 108488099 missense probably benign
R1846:Lamb2 UTSW 9 108487387 missense probably benign 0.00
R1863:Lamb2 UTSW 9 108481384 missense probably benign 0.13
R2184:Lamb2 UTSW 9 108480553 missense probably damaging 1.00
R2262:Lamb2 UTSW 9 108480610 missense probably damaging 1.00
R2338:Lamb2 UTSW 9 108482141 missense probably benign 0.20
R2483:Lamb2 UTSW 9 108480559 missense probably damaging 1.00
R4084:Lamb2 UTSW 9 108488018 missense probably benign 0.17
R4164:Lamb2 UTSW 9 108490298 missense probably damaging 1.00
R4295:Lamb2 UTSW 9 108486211 missense probably benign 0.42
R4422:Lamb2 UTSW 9 108483555 missense probably damaging 0.99
R4497:Lamb2 UTSW 9 108486798 missense probably damaging 1.00
R4880:Lamb2 UTSW 9 108484027 unclassified probably null
R4935:Lamb2 UTSW 9 108487501 missense possibly damaging 0.93
R4977:Lamb2 UTSW 9 108487647 missense probably damaging 0.99
R5152:Lamb2 UTSW 9 108487738 missense probably benign
R5499:Lamb2 UTSW 9 108487802 missense possibly damaging 0.50
R5724:Lamb2 UTSW 9 108480751 splice site probably null
R5932:Lamb2 UTSW 9 108480611 missense probably damaging 1.00
R5997:Lamb2 UTSW 9 108480388 missense possibly damaging 0.65
R6052:Lamb2 UTSW 9 108487612 nonsense probably null
R6142:Lamb2 UTSW 9 108485618 nonsense probably null
R6245:Lamb2 UTSW 9 108488199 splice site probably null
R6531:Lamb2 UTSW 9 108483726 missense possibly damaging 0.78
R6557:Lamb2 UTSW 9 108488400 missense probably damaging 1.00
R6562:Lamb2 UTSW 9 108487008 missense possibly damaging 0.56
R6997:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7024:Lamb2 UTSW 9 108489488 missense probably benign 0.00
R7146:Lamb2 UTSW 9 108484084 missense possibly damaging 0.94
R7261:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7288:Lamb2 UTSW 9 108488324 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CAACTGTGACCATTGTGCC -3'
(R):5'- AGGATCACAGTCACAGGCTG -3'

Sequencing Primer
(F):5'- TTGGAACTTCACCAGTGGC -3'
(R):5'- TCACAGGCTGCAAGAAAAGC -3'
Posted On2019-05-15