Incidental Mutation 'R7116:Ccdc88a'
ID551786
Institutional Source Beutler Lab
Gene Symbol Ccdc88a
Ensembl Gene ENSMUSG00000032740
Gene Namecoiled coil domain containing 88A
SynonymsGirdin, GIV, A430106J12Rik, D130005J21Rik, HkRP1, C130096N06Rik, C330012F17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location29373658-29510808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29504051 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1738 (A1738V)
Ref Sequence ENSEMBL: ENSMUSP00000048978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040182] [ENSMUST00000140194]
Predicted Effect probably benign
Transcript: ENSMUST00000040182
AA Change: A1738V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048978
Gene: ENSMUSG00000032740
AA Change: A1738V

DomainStartEndE-ValueType
Pfam:HOOK 14 590 8.1e-36 PFAM
low complexity region 614 625 N/A INTRINSIC
Blast:BRLZ 665 719 6e-22 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
low complexity region 955 985 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1268 1385 N/A INTRINSIC
low complexity region 1437 1444 N/A INTRINSIC
low complexity region 1566 1576 N/A INTRINSIC
internal_repeat_1 1609 1702 2.38e-6 PROSPERO
internal_repeat_1 1708 1808 2.38e-6 PROSPERO
low complexity region 1811 1824 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119173
Gene: ENSMUSG00000032740
AA Change: A718V

DomainStartEndE-ValueType
coiled coil region 1 212 N/A INTRINSIC
coiled coil region 248 365 N/A INTRINSIC
low complexity region 418 425 N/A INTRINSIC
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140194
SMART Domains Protein: ENSMUSP00000114942
Gene: ENSMUSG00000032740

DomainStartEndE-ValueType
coiled coil region 3 85 N/A INTRINSIC
low complexity region 137 144 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Girdin family of coiled-coil domain containing proteins. The encoded protein is an actin-binding protein that is activated by the serine/threonine kinase Akt and plays a role in cytoskeleton remodeling and cell migration. The encoded protein also enhances Akt signaling by mediating phosphoinositide 3-kinase (PI3K)-dependent activation of Akt by growth factor receptor tyrosine kinases and G protein-coupled receptors. Increased expression of this gene and phosphorylation of the encoded protein may play a role in cancer metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal weight loss, reduced angiogenesis, and premature death by P25. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Ccdc88a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Ccdc88a APN 11 29499341 missense probably benign 0.24
IGL00577:Ccdc88a APN 11 29424772 missense probably damaging 1.00
IGL00766:Ccdc88a APN 11 29501046 missense probably damaging 0.99
IGL01384:Ccdc88a APN 11 29503915 missense probably damaging 0.99
IGL01541:Ccdc88a APN 11 29400283 missense probably benign
IGL01647:Ccdc88a APN 11 29504321 unclassified probably benign
IGL02648:Ccdc88a APN 11 29501051 missense probably benign 0.28
IGL02885:Ccdc88a APN 11 29448050 missense probably damaging 1.00
IGL03117:Ccdc88a APN 11 29374559 missense probably damaging 1.00
IGL03196:Ccdc88a APN 11 29482340 missense possibly damaging 0.56
trailor UTSW 11 29494099 splice site probably null
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0083:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0108:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0326:Ccdc88a UTSW 11 29461021 missense probably benign 0.01
R0565:Ccdc88a UTSW 11 29461042 unclassified probably benign
R0631:Ccdc88a UTSW 11 29493752 missense probably damaging 0.98
R0632:Ccdc88a UTSW 11 29482749 unclassified probably benign
R0762:Ccdc88a UTSW 11 29463112 unclassified probably benign
R0838:Ccdc88a UTSW 11 29400285 missense probably damaging 1.00
R0946:Ccdc88a UTSW 11 29456509 missense probably benign
R1192:Ccdc88a UTSW 11 29504049 missense possibly damaging 0.45
R1500:Ccdc88a UTSW 11 29482713 missense probably benign 0.00
R1701:Ccdc88a UTSW 11 29477427 missense possibly damaging 0.59
R1826:Ccdc88a UTSW 11 29489637 missense possibly damaging 0.58
R1902:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R1903:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R2021:Ccdc88a UTSW 11 29503480 missense probably damaging 1.00
R2023:Ccdc88a UTSW 11 29463546 nonsense probably null
R2284:Ccdc88a UTSW 11 29494099 splice site probably null
R3236:Ccdc88a UTSW 11 29447995 missense possibly damaging 0.51
R3409:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3410:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3411:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3430:Ccdc88a UTSW 11 29448033 missense probably damaging 0.98
R3620:Ccdc88a UTSW 11 29430227 missense probably benign 0.16
R4204:Ccdc88a UTSW 11 29463399 missense probably damaging 1.00
R4515:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4518:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4519:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4693:Ccdc88a UTSW 11 29482241 missense probably damaging 1.00
R4705:Ccdc88a UTSW 11 29422586 missense probably benign
R4707:Ccdc88a UTSW 11 29447956 missense probably benign
R4732:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4733:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4734:Ccdc88a UTSW 11 29482720 missense probably benign
R4749:Ccdc88a UTSW 11 29482720 missense probably benign
R4817:Ccdc88a UTSW 11 29460907 missense probably benign 0.15
R4828:Ccdc88a UTSW 11 29463210 missense probably damaging 1.00
R4979:Ccdc88a UTSW 11 29482133 nonsense probably null
R5288:Ccdc88a UTSW 11 29498416 missense possibly damaging 0.77
R5373:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5374:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5401:Ccdc88a UTSW 11 29463279 missense probably benign 0.00
R5586:Ccdc88a UTSW 11 29503484 missense probably benign 0.00
R6660:Ccdc88a UTSW 11 29482663 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTCCTCGAGTCAAGAGAATC -3'
(R):5'- GTGATGAATCGACTGACACGG -3'

Sequencing Primer
(F):5'- GTCCTCGAGTCAAGAGAATCTTTTAG -3'
(R):5'- AAAATCATGGATGCTCGTCCTTCG -3'
Posted On2019-05-15