Incidental Mutation 'R7116:Dgkb'
ID551789
Institutional Source Beutler Lab
Gene Symbol Dgkb
Ensembl Gene ENSMUSG00000036095
Gene Namediacylglycerol kinase, beta
SynonymsC630029D13Rik, DGK-beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location37817726-38634239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37981990 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 17 (Q17R)
Ref Sequence ENSEMBL: ENSMUSP00000037900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040500] [ENSMUST00000220990] [ENSMUST00000221176] [ENSMUST00000222337]
Predicted Effect probably benign
Transcript: ENSMUST00000040500
AA Change: Q17R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037900
Gene: ENSMUSG00000036095
AA Change: Q17R

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 6 141 1.4e-49 PFAM
EFh 145 173 1.82e-4 SMART
EFh 190 218 1.18e-3 SMART
C1 235 286 7.11e-16 SMART
C1 302 350 9.25e-6 SMART
DAGKc 429 553 2.58e-68 SMART
DAGKa 573 753 8.02e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220990
AA Change: Q17R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000221176
AA Change: Q17R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000222337
AA Change: Q17R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diacylglycerol kinases (DGKs) are regulators of the intracellular concentration of the second messenger diacylglycerol (DAG) and thus play a key role in cellular processes. Nine mammalian isotypes have been identified, which are encoded by separate genes. Mammalian DGK isozymes contain a conserved catalytic (kinase) domain and a cysteine-rich domain (CRD). The protein encoded by this gene is a diacylglycerol kinase, beta isotype. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon distruption have defects in long term potentiation, synapase morphology, and in spatial reference and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Dgkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Dgkb APN 12 38438568 missense probably benign 0.05
IGL00768:Dgkb APN 12 38427479 missense probably benign 0.00
IGL00792:Dgkb APN 12 38214389 critical splice donor site probably null
IGL00934:Dgkb APN 12 38427456 missense probably damaging 0.98
IGL00970:Dgkb APN 12 38190083 missense probably damaging 1.00
IGL01152:Dgkb APN 12 38084234 missense probably damaging 1.00
IGL01489:Dgkb APN 12 38127385 critical splice donor site probably null
IGL01993:Dgkb APN 12 37982010 missense probably benign 0.19
IGL02212:Dgkb APN 12 38139414 missense probably damaging 1.00
IGL02687:Dgkb APN 12 38630629 missense possibly damaging 0.94
IGL02986:Dgkb APN 12 38100400 missense possibly damaging 0.88
IGL03155:Dgkb APN 12 38139459 missense probably damaging 1.00
IGL03174:Dgkb APN 12 38216054 missense possibly damaging 0.93
IGL03198:Dgkb APN 12 38136616 missense probably damaging 0.97
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0078:Dgkb UTSW 12 38136541 missense probably benign 0.35
R0271:Dgkb UTSW 12 38228026 missense probably damaging 1.00
R0359:Dgkb UTSW 12 38216031 missense probably benign 0.17
R0396:Dgkb UTSW 12 38190135 critical splice donor site probably null
R0547:Dgkb UTSW 12 38604158 missense probably benign 0.39
R0554:Dgkb UTSW 12 38216031 missense probably benign 0.17
R1903:Dgkb UTSW 12 38166777 critical splice donor site probably null
R2004:Dgkb UTSW 12 38084229 missense probably damaging 1.00
R2265:Dgkb UTSW 12 38190108 missense possibly damaging 0.61
R2941:Dgkb UTSW 12 38604123 missense possibly damaging 0.96
R3177:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R3277:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R4319:Dgkb UTSW 12 38438599 missense probably damaging 1.00
R4446:Dgkb UTSW 12 38184953 missense probably damaging 0.99
R4578:Dgkb UTSW 12 38427493 missense possibly damaging 0.87
R4601:Dgkb UTSW 12 38602820 missense probably damaging 0.96
R4799:Dgkb UTSW 12 38114568 missense possibly damaging 0.89
R4937:Dgkb UTSW 12 38114658 nonsense probably null
R5380:Dgkb UTSW 12 38127300 missense possibly damaging 0.89
R5485:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R5556:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R6198:Dgkb UTSW 12 38173823 missense probably benign
R6467:Dgkb UTSW 12 38084224 missense possibly damaging 0.65
R6467:Dgkb UTSW 12 38604105 missense probably damaging 1.00
R6792:Dgkb UTSW 12 38100425 missense possibly damaging 0.48
R7056:Dgkb UTSW 12 38100493 missense probably benign
R7251:Dgkb UTSW 12 37981986 missense possibly damaging 0.77
R7265:Dgkb UTSW 12 38184932 missense possibly damaging 0.91
R7268:Dgkb UTSW 12 38147555 nonsense probably null
X0023:Dgkb UTSW 12 38227989 missense probably benign 0.00
X0027:Dgkb UTSW 12 38228125 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGAGTGTGTATTCTGGAAGCC -3'
(R):5'- CAGCAATGTTTACCAGGCTTAG -3'

Sequencing Primer
(F):5'- GCCAGAGCTATTTCATCATGAAAC -3'
(R):5'- ATGCTAAAAGGCAATCTTAAAATGAC -3'
Posted On2019-05-15