Incidental Mutation 'R7116:Ptdss1'
ID551793
Institutional Source Beutler Lab
Gene Symbol Ptdss1
Ensembl Gene ENSMUSG00000021518
Gene Namephosphatidylserine synthase 1
SynonymsPSS-1, PtdSer Synthase-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location66932830-66998401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66945327 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 77 (I77N)
Ref Sequence ENSEMBL: ENSMUSP00000021990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021990] [ENSMUST00000224244] [ENSMUST00000224290]
Predicted Effect probably benign
Transcript: ENSMUST00000021990
AA Change: I77N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021990
Gene: ENSMUSG00000021518
AA Change: I77N

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 72 89 N/A INTRINSIC
Pfam:PSS 96 372 1.3e-108 PFAM
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224244
Predicted Effect probably benign
Transcript: ENSMUST00000224290
AA Change: I77N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably null
Transcript: ENSMUST00000225347
AA Change: Y1*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of phosphatidylserine from either phosphatidylcholine or phosphatidylethanolamine. Phosphatidylserine localizes to the mitochondria-associated membrane of the endoplasmic reticulum, where it serves a structural role as well as a signaling role. Defects in this gene are a cause of Lenz-Majewski hyperostotic dwarfism. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased phosphatidylethanolamine and phosphatidylserine levels in the liver but normal axon growth and life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Ptdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Ptdss1 APN 13 66987822 missense probably benign 0.02
IGL02798:Ptdss1 APN 13 66976760 missense probably damaging 1.00
IGL03114:Ptdss1 APN 13 66993994 nonsense probably null
R0344:Ptdss1 UTSW 13 66933572 missense probably damaging 1.00
R0591:Ptdss1 UTSW 13 66972650 splice site probably benign
R0749:Ptdss1 UTSW 13 66987850 nonsense probably null
R0759:Ptdss1 UTSW 13 66987804 missense probably damaging 1.00
R1140:Ptdss1 UTSW 13 66963356 missense probably benign 0.00
R1500:Ptdss1 UTSW 13 66995408 missense probably benign 0.04
R1676:Ptdss1 UTSW 13 66933637 missense probably damaging 1.00
R1761:Ptdss1 UTSW 13 66956412 missense possibly damaging 0.72
R2086:Ptdss1 UTSW 13 66953555 missense probably benign 0.00
R2087:Ptdss1 UTSW 13 66976817 splice site probably benign
R3962:Ptdss1 UTSW 13 66994011 missense probably benign 0.00
R4662:Ptdss1 UTSW 13 66933611 missense possibly damaging 0.95
R4707:Ptdss1 UTSW 13 66995418 critical splice donor site probably null
R4775:Ptdss1 UTSW 13 66987858 splice site probably null
R4993:Ptdss1 UTSW 13 66945288 missense probably benign 0.01
R5402:Ptdss1 UTSW 13 66933599 missense possibly damaging 0.88
R5463:Ptdss1 UTSW 13 66945301 missense probably damaging 1.00
R5643:Ptdss1 UTSW 13 66972540 missense probably damaging 1.00
R5644:Ptdss1 UTSW 13 66972540 missense probably damaging 1.00
R6043:Ptdss1 UTSW 13 66963369 missense probably damaging 1.00
R6145:Ptdss1 UTSW 13 66972637 critical splice donor site probably null
R6726:Ptdss1 UTSW 13 66953531 nonsense probably null
R7016:Ptdss1 UTSW 13 66972621 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACCTGGGCTTTACTGTGAG -3'
(R):5'- GGCCAATCTAGCTACTGAGTC -3'

Sequencing Primer
(F):5'- GCTTTAGGATGTGACACTGAAG -3'
(R):5'- GCCAATCTAGCTACTGAGTCTATATC -3'
Posted On2019-05-15