Incidental Mutation 'R7116:H2-Aa'
ID551802
Institutional Source Beutler Lab
Gene Symbol H2-Aa
Ensembl Gene ENSMUSG00000036594
Gene Namehistocompatibility 2, class II antigen A, alpha
SynonymsH-2Aa, I-Aalpha, Ia-1, Aalpha, Ia1, A alpha
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34282744-34287827 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 34283627 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 188 (Y188*)
Ref Sequence ENSEMBL: ENSMUSP00000046105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040655] [ENSMUST00000174751]
PDB Structure
CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION]
Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION]
J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION]
J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION]
14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000040655
AA Change: Y188*
SMART Domains Protein: ENSMUSP00000046105
Gene: ENSMUSG00000036594
AA Change: Y188*

DomainStartEndE-ValueType
MHC_II_alpha 31 111 1.83e-45 SMART
IGc1 129 200 2.51e-27 SMART
Pfam:C1-set_C 203 255 2.1e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174751
AA Change: Y105*
SMART Domains Protein: ENSMUSP00000133399
Gene: ENSMUSG00000036594
AA Change: Y105*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc1 46 117 2.51e-27 SMART
low complexity region 141 158 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cell surface expression of MHC class II molecules on macrophages and show decreased CD4-positive T cell number, increased CD8-positive T cell number, thymus hyperplasia, enlarged lymph nodes, and altered splenocyte response to staphylococcal enterotoxin B. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in H2-Aa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:H2-Aa APN 17 34284530 missense probably damaging 1.00
citation UTSW 17 34287677 splice site probably null
R1556:H2-Aa UTSW 17 34284416 missense possibly damaging 0.94
R1901:H2-Aa UTSW 17 34283233 missense possibly damaging 0.65
R2144:H2-Aa UTSW 17 34283827 missense probably damaging 1.00
R4816:H2-Aa UTSW 17 34283820 missense probably damaging 1.00
R5607:H2-Aa UTSW 17 34283842 missense possibly damaging 0.89
R5608:H2-Aa UTSW 17 34283842 missense possibly damaging 0.89
R6264:H2-Aa UTSW 17 34283198 missense probably damaging 0.98
R6822:H2-Aa UTSW 17 34287677 splice site probably null
R6917:H2-Aa UTSW 17 34283707 missense probably damaging 1.00
R7052:H2-Aa UTSW 17 34284510 missense possibly damaging 0.50
X0063:H2-Aa UTSW 17 34287811 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCTTATGGAATGACATGAAATC -3'
(R):5'- AAGCGACTGTGTTCCCCAAG -3'

Sequencing Primer
(F):5'- GGAATGACATGAAATCTAGCTTTAGG -3'
(R):5'- AAGTCCCCTGTGCTGCTG -3'
Posted On2019-05-15