Incidental Mutation 'R7116:Stip1'
ID551804
Institutional Source Beutler Lab
Gene Symbol Stip1
Ensembl Gene ENSMUSG00000024966
Gene Namestress-induced phosphoprotein 1
SynonymsHop, IEF SSP 3521, Hsp70/Hsp90 organizing protein, STI1, p60
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location7020696-7040026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7021810 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 467 (G467S)
Ref Sequence ENSEMBL: ENSMUSP00000025918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025918] [ENSMUST00000040772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025918
AA Change: G467S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025918
Gene: ENSMUSG00000024966
AA Change: G467S

DomainStartEndE-ValueType
TPR 4 37 3.07e-5 SMART
TPR 38 71 1.63e0 SMART
TPR 72 105 5.87e-2 SMART
STI1 130 169 4.84e-1 SMART
low complexity region 192 220 N/A INTRINSIC
TPR 225 258 7.45e-4 SMART
TPR 259 292 1.1e-1 SMART
TPR 300 333 1.09e-5 SMART
TPR 360 393 1.07e-4 SMART
TPR 394 427 9.45e-6 SMART
TPR 428 461 3.29e-5 SMART
STI1 492 531 1.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040772
SMART Domains Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965

DomainStartEndE-ValueType
Blast:B41 14 77 6e-32 BLAST
B41 94 556 1.66e-28 SMART
PH 350 455 2.26e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] STIP1 is an adaptor protein that coordinates the functions of HSP70 (see HSPA1A; MIM 140550) and HSP90 (see HSP90AA1; MIM 140571) in protein folding. It is thought to assist in the transfer of proteins from HSP70 to HSP90 by binding both HSP90 and substrate-bound HSP70. STIP1 also stimulates the ATPase activity of HSP70 and inhibits the ATPase activity of HSP90, suggesting that it regulates both the conformations and ATPase cycles of these chaperones (Song and Masison, 2005 [PubMed 16100115]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality by E10.5, actute inflammation in the placental labyrinth, poorly formed neural tube and limb buds and increase double-strand breaks. Mice heterozygous for this allele exhibit susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Stip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Stip1 APN 19 7021096 unclassified probably benign
IGL02506:Stip1 APN 19 7035489 splice site probably benign
IGL02515:Stip1 APN 19 7022119 missense probably benign 0.23
IGL03009:Stip1 APN 19 7021121 missense probably damaging 1.00
R1768:Stip1 UTSW 19 7021797 missense probably damaging 1.00
R3081:Stip1 UTSW 19 7035648 missense probably benign 0.42
R4530:Stip1 UTSW 19 7035658 missense probably benign 0.04
R4965:Stip1 UTSW 19 7035570 missense probably benign 0.41
R5638:Stip1 UTSW 19 7032515 missense probably damaging 1.00
R5776:Stip1 UTSW 19 7022025 critical splice donor site probably null
R5840:Stip1 UTSW 19 7022068 missense possibly damaging 0.86
R7064:Stip1 UTSW 19 7035557 missense probably benign 0.18
R7096:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7109:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7111:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7117:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7127:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7129:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7130:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7132:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCTCAGGCACATAACCTC -3'
(R):5'- AAGGTAAGCTGCTGTTGGCC -3'

Sequencing Primer
(F):5'- GAATGATAGAATTCCCTCTCACTTC -3'
(R):5'- AAGCTGCTGTTGGCCTATAAC -3'
Posted On2019-05-15