Incidental Mutation 'R7116:Lpxn'
ID551805
Institutional Source Beutler Lab
Gene Symbol Lpxn
Ensembl Gene ENSMUSG00000024696
Gene Nameleupaxin
Synonyms4933402K05Rik, A530083L21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12798606-12833807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12811258 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 70 (N70K)
Ref Sequence ENSEMBL: ENSMUSP00000025601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025601]
Predicted Effect probably benign
Transcript: ENSMUST00000025601
AA Change: N70K

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025601
Gene: ENSMUSG00000024696
AA Change: N70K

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
LIM 151 202 3.17e-17 SMART
LIM 210 261 1.98e-18 SMART
LIM 269 320 3.26e-19 SMART
LIM 328 379 3.34e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is preferentially expressed in hematopoietic cells and belongs to the paxillin protein family. Similar to other members of this focal-adhesion-associated adaptor-protein family, it has four leucine-rich LD-motifs in the N-terminus and four LIM domains in the C-terminus. It may function in cell type-specific signaling by associating with PYK2, a member of focal adhesion kinase family. As a substrate for a tyrosine kinase in lymphoid cells, this protein may also function in, and be regulated by, tyrosine kinase activity. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Lpxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Lpxn APN 19 12833086 missense probably damaging 0.99
IGL03088:Lpxn APN 19 12833211 missense probably damaging 1.00
IGL03203:Lpxn APN 19 12819406 missense probably benign 0.01
mascherano UTSW 19 12833172 missense probably damaging 0.99
R0848:Lpxn UTSW 19 12804037 missense probably benign
R1514:Lpxn UTSW 19 12824050 missense probably damaging 1.00
R1532:Lpxn UTSW 19 12804092 critical splice donor site probably null
R1880:Lpxn UTSW 19 12804088 missense probably benign 0.17
R1937:Lpxn UTSW 19 12824910 missense probably benign 0.00
R2182:Lpxn UTSW 19 12832758 critical splice donor site probably null
R2897:Lpxn UTSW 19 12819358 missense probably benign 0.01
R4194:Lpxn UTSW 19 12833235 missense probably damaging 1.00
R4576:Lpxn UTSW 19 12833290 missense probably benign 0.17
R4844:Lpxn UTSW 19 12833172 missense probably damaging 0.99
R5567:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R5570:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R6060:Lpxn UTSW 19 12833125 missense probably damaging 1.00
R6366:Lpxn UTSW 19 12824799 missense probably benign 0.12
R6615:Lpxn UTSW 19 12824799 missense probably benign 0.12
R7135:Lpxn UTSW 19 12833319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTACCTTTGGAAATGCTTAAGC -3'
(R):5'- CTCAAAGGCTCTGGGAAGAG -3'

Sequencing Primer
(F):5'- AGATAAGCTCTCACTATGCTGC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2019-05-15