Incidental Mutation 'R7116:Pdzd8'
ID551806
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59299693 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1092 (E1092K)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]
Predicted Effect probably benign
Transcript: ENSMUST00000026084
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: E1092K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: E1092K

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCCTCCATCCATGTGAAAG -3'
(R):5'- AAGCTGGAGTTCATGTTGGATAAG -3'

Sequencing Primer
(F):5'- CCATCCATGTGAAAGTTGAAATAGC -3'
(R):5'- GAGTTCATGTTGGATAAGCTACAG -3'
Posted On2019-05-15