Incidental Mutation 'R7120:Tpte'
ID551934
Institutional Source Beutler Lab
Gene Symbol Tpte
Ensembl Gene ENSMUSG00000031481
Gene Nametransmembrane phosphatase with tensin homology
SynonymsPten2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7120 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location22283441-22371418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22327673 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 225 (D225G)
Ref Sequence ENSEMBL: ENSMUSP00000076435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077194] [ENSMUST00000211497] [ENSMUST00000211747]
Predicted Effect probably damaging
Transcript: ENSMUST00000077194
AA Change: D225G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076435
Gene: ENSMUSG00000031481
AA Change: D225G

DomainStartEndE-ValueType
low complexity region 146 167 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 246 265 N/A INTRINSIC
transmembrane domain 277 299 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
Pfam:Y_phosphatase 369 511 1.4e-6 PFAM
Pfam:DSPc 384 505 7.3e-8 PFAM
PTEN_C2 529 663 3.72e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211497
Predicted Effect probably damaging
Transcript: ENSMUST00000211747
AA Change: D225G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TPIP is a member of a large class of membrane-associated phosphatases with substrate specificity for the 3-position phosphate of inositol phospholipids.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik A T 3: 36,481,867 Q94L unknown Het
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Actr3 A C 1: 125,403,432 Y273* probably null Het
Aoc1 T A 6: 48,906,597 I469N probably damaging Het
Arhgef28 A T 13: 97,944,539 L1270Q probably damaging Het
Atp2c1 G A 9: 105,420,186 Q780* probably null Het
Bbs10 T C 10: 111,299,449 V141A possibly damaging Het
Bivm A T 1: 44,126,446 T19S probably benign Het
Cacna1h T G 17: 25,391,507 H675P probably benign Het
Cadps T A 14: 12,439,919 L1204F probably damaging Het
Cald1 T C 6: 34,686,076 probably null Het
Calr A G 8: 84,842,828 M357T probably damaging Het
Ccni A T 5: 93,183,331 Y260* probably null Het
Csrnp3 C A 2: 66,023,010 T594K probably damaging Het
Dek A T 13: 47,100,183 M152K unknown Het
Depdc1b T C 13: 108,362,247 W155R probably benign Het
Ehd1 A G 19: 6,297,561 K315R probably benign Het
Epn3 C A 11: 94,492,428 R323S probably benign Het
Fam57b T C 7: 126,829,333 L221P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxo10 T A 4: 45,040,533 K891* probably null Het
Fras1 G T 5: 96,752,960 G3013* probably null Het
Gbp2b A G 3: 142,606,746 T297A probably benign Het
Gbp7 T C 3: 142,543,973 S402P probably damaging Het
Gclc T C 9: 77,786,750 Y329H probably damaging Het
Gfpt1 A G 6: 87,087,393 H655R probably benign Het
Gm4787 C A 12: 81,378,486 M299I probably benign Het
Grb7 C A 11: 98,454,991 R532S probably benign Het
Hmcn1 A T 1: 150,700,541 I2066N probably damaging Het
Hnrnpll T C 17: 80,034,057 T518A probably benign Het
Hps3 G A 3: 20,011,541 R712W probably damaging Het
Hspd1 A G 1: 55,079,229 V406A probably benign Het
Igkv2-112 T C 6: 68,220,526 F61L probably benign Het
Iqcf5 G A 9: 106,515,796 R84H probably damaging Het
Itgad T A 7: 128,173,974 M1K probably null Het
Kmt2d A G 15: 98,861,065 S1292P unknown Het
Macc1 C A 12: 119,445,745 Q83K possibly damaging Het
Map3k4 G T 17: 12,271,467 A359E probably damaging Het
Mfap3 T A 11: 57,528,217 C68S probably damaging Het
Mipep C T 14: 60,875,247 R660C possibly damaging Het
Morc2b A T 17: 33,135,813 L995Q probably damaging Het
Mrc1 A G 2: 14,308,697 N913S probably damaging Het
N4bp1 C A 8: 86,860,867 C481F probably benign Het
Nae1 A G 8: 104,526,278 probably null Het
Nup214 T A 2: 32,051,042 V29E probably benign Het
Olfr251 T C 9: 38,378,649 L250P probably damaging Het
Olfr390 A T 11: 73,787,114 M59L probably damaging Het
Orai1 A G 5: 123,029,472 E236G possibly damaging Het
P2rx7 A G 5: 122,681,294 Y593C probably benign Het
Pcbp2 A G 15: 102,474,678 D77G possibly damaging Het
Pcdha8 G A 18: 36,993,787 V441M possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plaa A G 4: 94,582,682 S406P possibly damaging Het
Plekhh1 C A 12: 79,070,939 P903Q probably benign Het
Plekhh3 T C 11: 101,168,238 E92G probably damaging Het
Ptpn9 T C 9: 57,059,882 F463S probably damaging Het
Ptprn2 A C 12: 116,872,056 E337A probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Samd3 C T 10: 26,230,966 T73M possibly damaging Het
Sfxn4 T A 19: 60,852,039 K173* probably null Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Son T G 16: 91,670,526 N2258K unknown Het
Sspo A T 6: 48,465,571 H2000L probably benign Het
Syne1 C T 10: 5,293,971 S2731N probably benign Het
Syt6 T C 3: 103,587,357 Y213H probably damaging Het
Tkt A G 14: 30,559,822 N99S probably benign Het
Tmem258 G A 19: 10,204,238 probably benign Het
Tnks1bp1 T C 2: 85,072,097 S1702P probably damaging Het
Trak1 T A 9: 121,460,498 F625L probably benign Het
Ttc33 G T 15: 5,212,007 C77F probably benign Het
Ugt1a2 A G 1: 88,200,800 H55R probably damaging Het
Vmn1r169 G T 7: 23,578,019 V279L probably benign Het
Vmn2r25 T C 6: 123,828,435 K488E possibly damaging Het
Vmn2r8 A T 5: 108,808,638 D39E possibly damaging Het
Other mutations in Tpte
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Tpte APN 8 22320882 missense probably benign 0.03
IGL01456:Tpte APN 8 22345052 splice site probably benign
IGL01947:Tpte APN 8 22355473 missense possibly damaging 0.88
IGL01975:Tpte APN 8 22349337 missense probably damaging 1.00
IGL02458:Tpte APN 8 22305858 missense probably benign
IGL03411:Tpte APN 8 22325537 missense possibly damaging 0.64
R0158:Tpte UTSW 8 22327739 missense possibly damaging 0.47
R0396:Tpte UTSW 8 22335608 splice site probably benign
R0611:Tpte UTSW 8 22336533 missense possibly damaging 0.68
R1481:Tpte UTSW 8 22355471 missense probably damaging 1.00
R1489:Tpte UTSW 8 22349389 critical splice donor site probably null
R1569:Tpte UTSW 8 22345031 missense probably damaging 0.98
R1632:Tpte UTSW 8 22349347 missense probably damaging 0.98
R1639:Tpte UTSW 8 22320897 missense probably benign 0.00
R2030:Tpte UTSW 8 22345885 missense probably damaging 1.00
R2057:Tpte UTSW 8 22318339 missense probably benign 0.13
R2519:Tpte UTSW 8 22333160 splice site probably benign
R2655:Tpte UTSW 8 22311278 critical splice acceptor site probably null
R2884:Tpte UTSW 8 22335423 nonsense probably null
R3033:Tpte UTSW 8 22320872 missense possibly damaging 0.84
R3734:Tpte UTSW 8 22359482 missense probably damaging 1.00
R3961:Tpte UTSW 8 22359415 missense probably damaging 0.99
R4050:Tpte UTSW 8 22365984 missense probably damaging 1.00
R4591:Tpte UTSW 8 22327775 missense probably benign 0.08
R4994:Tpte UTSW 8 22318346 missense probably benign 0.23
R5321:Tpte UTSW 8 22297203 nonsense probably null
R5394:Tpte UTSW 8 22327790 missense probably damaging 1.00
R5588:Tpte UTSW 8 22284967 missense possibly damaging 0.95
R5590:Tpte UTSW 8 22351452 missense probably damaging 1.00
R5670:Tpte UTSW 8 22327748 missense probably damaging 1.00
R6544:Tpte UTSW 8 22315105 critical splice donor site probably null
R6596:Tpte UTSW 8 22333269 missense probably damaging 0.99
R6729:Tpte UTSW 8 22355475 missense probably damaging 1.00
R7526:Tpte UTSW 8 22325547 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCGCTACTTTTATTGGGTGAAAGC -3'
(R):5'- CCACTGTTTGAGCTGATCTGAC -3'

Sequencing Primer
(F):5'- TTATTGGGTGAAAGCTGAACTTC -3'
(R):5'- ACTGTTTGAGCTGATCTGACATTTC -3'
Posted On2019-05-15