Incidental Mutation 'R7121:Ubr1'
ID551983
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R7121 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120875498 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1495 (L1495F)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect probably benign
Transcript: ENSMUST00000028728
AA Change: L1495F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: L1495F

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Akap10 A G 11: 61,886,698 probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Odf2l G A 3: 145,139,820 V363I possibly damaging Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr1458 T A 19: 13,103,173 I44F probably benign Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Pcnt A G 10: 76,427,927 V401A possibly damaging Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Sgca G A 11: 94,969,547 P255S possibly damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Taar2 T G 10: 23,940,827 S88R probably damaging Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 synonymous probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 intron probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAAGTCTCCATTCGCTGTC -3'
(R):5'- TTTTCAAAGTCTCCCTGGTAGAGG -3'

Sequencing Primer
(F):5'- CCATTCGCTGTCTGATTTCAG -3'
(R):5'- AGCCCTTGGAGAGTCTTTGCC -3'
Posted On2019-05-15