Incidental Mutation 'R7121:Odf2l'
ID551988
Institutional Source Beutler Lab
Gene Symbol Odf2l
Ensembl Gene ENSMUSG00000028256
Gene Nameouter dense fiber of sperm tails 2-like
Synonyms9630045K08Rik, 4733401D09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7121 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location145118588-145153915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145139820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 363 (V363I)
Ref Sequence ENSEMBL: ENSMUSP00000096140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029920] [ENSMUST00000098538] [ENSMUST00000098539] [ENSMUST00000106192]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029920
AA Change: V320I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029920
Gene: ENSMUSG00000028256
AA Change: V320I

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
coiled coil region 85 183 N/A INTRINSIC
coiled coil region 206 367 N/A INTRINSIC
coiled coil region 388 508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098538
AA Change: V363I

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096140
Gene: ENSMUSG00000028256
AA Change: V363I

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 604 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098539
AA Change: V363I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096141
Gene: ENSMUSG00000028256
AA Change: V363I

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106192
AA Change: V363I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101798
Gene: ENSMUSG00000028256
AA Change: V363I

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000198764
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Akap10 A G 11: 61,886,698 probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr1458 T A 19: 13,103,173 I44F probably benign Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Pcnt A G 10: 76,427,927 V401A possibly damaging Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Sgca G A 11: 94,969,547 P255S possibly damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Taar2 T G 10: 23,940,827 S88R probably damaging Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Ubr1 G A 2: 120,875,498 L1495F probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Odf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Odf2l APN 3 145127873 missense possibly damaging 0.93
IGL00821:Odf2l APN 3 145150987 missense probably damaging 1.00
IGL01984:Odf2l APN 3 145139829 nonsense probably null
R0080:Odf2l UTSW 3 145124323 missense possibly damaging 0.63
R0133:Odf2l UTSW 3 145148541 missense probably damaging 0.96
R0436:Odf2l UTSW 3 145126116 missense possibly damaging 0.91
R1218:Odf2l UTSW 3 145148932 missense probably damaging 1.00
R1521:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R1677:Odf2l UTSW 3 145139782 critical splice acceptor site probably null
R1884:Odf2l UTSW 3 145151048 missense probably damaging 1.00
R2151:Odf2l UTSW 3 145149024 missense possibly damaging 0.86
R2910:Odf2l UTSW 3 145124323 missense probably benign 0.00
R2911:Odf2l UTSW 3 145124323 missense probably benign 0.00
R4552:Odf2l UTSW 3 145151083 missense probably benign 0.02
R4640:Odf2l UTSW 3 145128945 missense probably damaging 1.00
R4667:Odf2l UTSW 3 145128040 missense probably benign 0.04
R5472:Odf2l UTSW 3 145146866 missense probably benign 0.00
R5769:Odf2l UTSW 3 145135731 missense possibly damaging 0.91
R5877:Odf2l UTSW 3 145129010 unclassified probably null
R6026:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6351:Odf2l UTSW 3 145135718 missense probably benign 0.11
R6454:Odf2l UTSW 3 145153420 missense possibly damaging 0.93
R6462:Odf2l UTSW 3 145146911 missense probably damaging 1.00
R6888:Odf2l UTSW 3 145148618 critical splice donor site probably null
R7008:Odf2l UTSW 3 145132734 missense probably damaging 1.00
R7151:Odf2l UTSW 3 145127066 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCTGCCAACTGAGATTTGAGTTAG -3'
(R):5'- TATGCCACAGAGATTTGCCCC -3'

Sequencing Primer
(F):5'- GCCAACTGAGATTTGAGTTAGTTTTG -3'
(R):5'- AGAGATTTGCCCCACATCTTCAG -3'
Posted On2019-05-15