Incidental Mutation 'R7121:Taar2'
ID552020
Institutional Source Beutler Lab
Gene Symbol Taar2
Ensembl Gene ENSMUSG00000059763
Gene Nametrace amine-associated receptor 2
SynonymsGpr58
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7121 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23938572-23941583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23940827 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 88 (S88R)
Ref Sequence ENSEMBL: ENSMUSP00000078137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079134]
Predicted Effect probably damaging
Transcript: ENSMUST00000079134
AA Change: S88R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078137
Gene: ENSMUSG00000059763
AA Change: S88R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 318 2.4e-10 PFAM
Pfam:7tm_1 48 303 2.9e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Akap10 A G 11: 61,886,698 probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Odf2l G A 3: 145,139,820 V363I possibly damaging Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr1458 T A 19: 13,103,173 I44F probably benign Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Pcnt A G 10: 76,427,927 V401A possibly damaging Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Sgca G A 11: 94,969,547 P255S possibly damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Ubr1 G A 2: 120,875,498 L1495F probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Taar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Taar2 APN 10 23941368 missense possibly damaging 0.50
IGL00807:Taar2 APN 10 23940675 missense probably benign 0.00
IGL01346:Taar2 APN 10 23941099 missense probably damaging 1.00
IGL01433:Taar2 APN 10 23940759 missense probably benign 0.02
IGL01782:Taar2 APN 10 23941144 missense probably damaging 1.00
IGL03106:Taar2 APN 10 23941297 missense probably damaging 0.99
IGL03372:Taar2 APN 10 23941171 missense probably benign 0.03
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0090:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0103:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0157:Taar2 UTSW 10 23941491 missense probably damaging 1.00
R0189:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0190:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0226:Taar2 UTSW 10 23941063 missense probably damaging 1.00
R0226:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0265:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0267:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0349:Taar2 UTSW 10 23941429 missense possibly damaging 0.79
R0349:Taar2 UTSW 10 23941509 missense probably benign 0.01
R0426:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0556:Taar2 UTSW 10 23940895 missense probably damaging 1.00
R0698:Taar2 UTSW 10 23941495 missense probably benign 0.00
R1191:Taar2 UTSW 10 23941029 missense probably damaging 1.00
R2919:Taar2 UTSW 10 23941556 missense probably benign 0.00
R4615:Taar2 UTSW 10 23941365 missense probably benign 0.43
R4658:Taar2 UTSW 10 23941503 missense probably benign 0.04
R4766:Taar2 UTSW 10 23940771 missense probably damaging 0.98
R4872:Taar2 UTSW 10 23940693 missense probably benign 0.02
R5205:Taar2 UTSW 10 23940976 missense probably benign 0.42
R5271:Taar2 UTSW 10 23941032 missense probably damaging 0.97
R5517:Taar2 UTSW 10 23940729 missense possibly damaging 0.92
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6325:Taar2 UTSW 10 23940717 missense probably benign 0.05
R6398:Taar2 UTSW 10 23941279 missense probably benign 0.00
R6762:Taar2 UTSW 10 23941402 missense probably damaging 0.98
R7209:Taar2 UTSW 10 23940699 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- TACGGAAATGGATCTTGCCCAG -3'
(R):5'- TAACGACCGGGATAGTCATTTTG -3'

Sequencing Primer
(F):5'- ATGAAAGATCTCTCGGCGTC -3'
(R):5'- GGATAGTCATTTTGGTGCAATAATG -3'
Posted On2019-05-15