Incidental Mutation 'R7121:Sgca'
ID552026
Institutional Source Beutler Lab
Gene Symbol Sgca
Ensembl Gene ENSMUSG00000001508
Gene Namesarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms50DAG, adhalin, Asg
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R7121 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location94962791-94976327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94969547 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 255 (P255S)
Ref Sequence ENSEMBL: ENSMUSP00000098118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038928] [ENSMUST00000100551] [ENSMUST00000103162] [ENSMUST00000139855] [ENSMUST00000152042] [ENSMUST00000166320]
Predicted Effect probably benign
Transcript: ENSMUST00000038928
SMART Domains Protein: ENSMUSP00000039866
Gene: ENSMUSG00000038994

DomainStartEndE-ValueType
Pfam:Linker_histone 35 106 5.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100551
AA Change: P255S

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098118
Gene: ENSMUSG00000001508
AA Change: P255S

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103162
AA Change: P255S

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099451
Gene: ENSMUSG00000001508
AA Change: P255S

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139855
AA Change: P8S

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117637
Gene: ENSMUSG00000001508
AA Change: P8S

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 1 140 2.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152042
SMART Domains Protein: ENSMUSP00000118455
Gene: ENSMUSG00000001508

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 6 100 5.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166320
AA Change: P255S

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130617
Gene: ENSMUSG00000001508
AA Change: P255S

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the sarcoglycan alpha/epsilon family of transmembrane proteins. The encoded protein is part of the dystrophin-glycoprotein complex which links the extracellular matrix to the cytoskeleton in muscle fibers. Disruption of this gene results in progressive muscular dystrophy and is associated with the development of embryonal rhabdomysarcoma. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mutation of this gene results in muscle abnormalities, with decreased skeletal muscle force and stiffness and muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Akap10 A G 11: 61,886,698 probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Odf2l G A 3: 145,139,820 V363I possibly damaging Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr1458 T A 19: 13,103,173 I44F probably benign Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Pcnt A G 10: 76,427,927 V401A possibly damaging Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Taar2 T G 10: 23,940,827 S88R probably damaging Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Ubr1 G A 2: 120,875,498 L1495F probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Sgca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Sgca APN 11 94972287 missense probably damaging 1.00
IGL01479:Sgca APN 11 94963378 nonsense probably null
IGL02153:Sgca APN 11 94963284 missense probably damaging 1.00
IGL02713:Sgca APN 11 94971305 missense probably damaging 1.00
IGL02928:Sgca APN 11 94972303 missense probably damaging 1.00
IGL03185:Sgca APN 11 94970784 missense probably benign 0.00
R0602:Sgca UTSW 11 94963235 missense possibly damaging 0.94
R0834:Sgca UTSW 11 94970686 nonsense probably null
R1547:Sgca UTSW 11 94969433 missense probably damaging 1.00
R1703:Sgca UTSW 11 94969391 missense probably damaging 0.97
R4110:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4112:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4796:Sgca UTSW 11 94970727 unclassified probably null
R5301:Sgca UTSW 11 94963331 missense probably damaging 1.00
R6301:Sgca UTSW 11 94972567 missense probably damaging 1.00
R6347:Sgca UTSW 11 94972028 missense probably damaging 1.00
R6510:Sgca UTSW 11 94963232 missense probably benign 0.36
R7110:Sgca UTSW 11 94963401 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTAGATGCGTCAATGTGCCC -3'
(R):5'- TCTGTAGTCACATGGGCTAGAGG -3'

Sequencing Primer
(F):5'- GTCAATGTGCCCTGTCCAG -3'
(R):5'- TCACATGGGCTAGAGGAGATG -3'
Posted On2019-05-15