Incidental Mutation 'R7122:Plxna2'
ID552049
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Nameplexin A2
Synonyms2810428A13Rik, OCT, PlexA2, Plxn2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7122 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location194618218-194816869 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 194644568 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 270 (S270*)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
PDB Structure
Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000027952
AA Change: S270*
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: S270*

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,511,276 E126V probably benign Het
Alg3 A T 16: 20,607,852 L213H probably damaging Het
Atp1a4 T A 1: 172,231,936 Y863F possibly damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Aup1 A G 6: 83,055,142 T97A probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cdc42bpa T C 1: 180,065,018 L249P probably damaging Het
Celsr3 A G 9: 108,828,567 K750E possibly damaging Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Csmd2 G A 4: 128,449,227 V1471M Het
Dnah12 G A 14: 26,778,912 probably null Het
E330017A01Rik C A 16: 58,637,777 A54S probably benign Het
Fbxw24 A T 9: 109,601,260 C439S probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gmip C T 8: 69,817,802 P721S probably benign Het
Grip1 A G 10: 120,035,374 I669V possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Herc1 G T 9: 66,399,774 A959S possibly damaging Het
Hic1 A G 11: 75,169,230 V97A probably benign Het
Il11ra1 A G 4: 41,766,189 Y242C probably damaging Het
Iqsec3 A C 6: 121,473,358 V69G unknown Het
Jak3 T A 8: 71,685,957 M933K probably damaging Het
Kbtbd7 G A 14: 79,428,317 V530I probably damaging Het
Kif22 G A 7: 127,032,978 R345C probably benign Het
Klhl7 G A 5: 24,138,435 E250K probably damaging Het
Klk1b4 A G 7: 44,211,107 H183R probably damaging Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Lhx5 T A 5: 120,436,345 M238K probably benign Het
Lin28b A T 10: 45,469,148 H27Q probably benign Het
Mgat4c A T 10: 102,378,209 R18* probably null Het
Myct1 C A 10: 5,604,492 H120N probably damaging Het
Nek1 A T 8: 61,106,795 D984V probably benign Het
Nfu1 A T 6: 87,009,881 probably benign Het
Nipsnap1 A T 11: 4,883,366 probably null Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nrxn3 T A 12: 89,510,607 M520K probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G A 2: 36,734,424 M34I probably benign Het
Olfr448 T C 6: 42,897,090 V213A probably damaging Het
Olfr669 T C 7: 104,939,198 L224P probably damaging Het
Otogl C T 10: 107,866,654 A713T probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Plpp4 G T 7: 129,379,483 V153F unknown Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Ptpn21 C T 12: 98,688,912 V599I probably damaging Het
Rab26 C A 17: 24,530,678 R131L probably damaging Het
Raph1 A T 1: 60,525,977 V117D probably benign Het
Sacs T C 14: 61,210,396 V3297A probably damaging Het
Serpine1 C A 5: 137,066,942 A262S probably benign Het
Sgf29 A G 7: 126,672,049 D193G probably null Het
Sipa1l1 T C 12: 82,422,462 V1245A possibly damaging Het
Slc22a7 A G 17: 46,438,298 L31P probably damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Slc26a7 A T 4: 14,533,639 Y395N probably damaging Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Susd1 G A 4: 59,411,318 R225* probably null Het
Suz12 T A 11: 79,993,593 F92I probably damaging Het
Tmem114 C A 16: 8,424,746 probably benign Het
Tmem68 A G 4: 3,564,107 V159A probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trim45 A G 3: 100,932,037 T752A unknown Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Vmn2r39 T G 7: 9,014,762 K858N possibly damaging Het
Zfp629 A T 7: 127,611,312 S442T probably damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 intron probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAATGCTGGACTATGAGCTCC -3'
(R):5'- TTCTGCCCCTTGGAGAAGATG -3'

Sequencing Primer
(F):5'- TGGACTATGAGCTCCACAGTG -3'
(R):5'- AACAGGACATCTTCGTCGCTG -3'
Posted On2019-05-15