Incidental Mutation 'R7122:Tmem68'
ID552055
Institutional Source Beutler Lab
Gene Symbol Tmem68
Ensembl Gene ENSMUSG00000028232
Gene Nametransmembrane protein 68
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R7122 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location3549041-3574853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3564107 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 159 (V159A)
Ref Sequence ENSEMBL: ENSMUSP00000029891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029891] [ENSMUST00000154922]
Predicted Effect probably benign
Transcript: ENSMUST00000029891
AA Change: V159A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029891
Gene: ENSMUSG00000028232
AA Change: V159A

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
PlsC 123 238 3.98e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154922
AA Change: V159A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123591
Gene: ENSMUSG00000028232
AA Change: V159A

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
Blast:PlsC 75 112 4e-15 BLAST
Blast:PlsC 123 163 1e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,511,276 E126V probably benign Het
Alg3 A T 16: 20,607,852 L213H probably damaging Het
Atp1a4 T A 1: 172,231,936 Y863F possibly damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Aup1 A G 6: 83,055,142 T97A probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cdc42bpa T C 1: 180,065,018 L249P probably damaging Het
Celsr3 A G 9: 108,828,567 K750E possibly damaging Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Csmd2 G A 4: 128,449,227 V1471M Het
Dnah12 G A 14: 26,778,912 probably null Het
E330017A01Rik C A 16: 58,637,777 A54S probably benign Het
Fbxw24 A T 9: 109,601,260 C439S probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gmip C T 8: 69,817,802 P721S probably benign Het
Grip1 A G 10: 120,035,374 I669V possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Herc1 G T 9: 66,399,774 A959S possibly damaging Het
Hic1 A G 11: 75,169,230 V97A probably benign Het
Il11ra1 A G 4: 41,766,189 Y242C probably damaging Het
Iqsec3 A C 6: 121,473,358 V69G unknown Het
Jak3 T A 8: 71,685,957 M933K probably damaging Het
Kbtbd7 G A 14: 79,428,317 V530I probably damaging Het
Kif22 G A 7: 127,032,978 R345C probably benign Het
Klhl7 G A 5: 24,138,435 E250K probably damaging Het
Klk1b4 A G 7: 44,211,107 H183R probably damaging Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Lhx5 T A 5: 120,436,345 M238K probably benign Het
Lin28b A T 10: 45,469,148 H27Q probably benign Het
Mgat4c A T 10: 102,378,209 R18* probably null Het
Myct1 C A 10: 5,604,492 H120N probably damaging Het
Nek1 A T 8: 61,106,795 D984V probably benign Het
Nfu1 A T 6: 87,009,881 probably benign Het
Nipsnap1 A T 11: 4,883,366 probably null Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nrxn3 T A 12: 89,510,607 M520K probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G A 2: 36,734,424 M34I probably benign Het
Olfr448 T C 6: 42,897,090 V213A probably damaging Het
Olfr669 T C 7: 104,939,198 L224P probably damaging Het
Otogl C T 10: 107,866,654 A713T probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Plpp4 G T 7: 129,379,483 V153F unknown Het
Plxna2 C A 1: 194,644,568 S270* probably null Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Ptpn21 C T 12: 98,688,912 V599I probably damaging Het
Rab26 C A 17: 24,530,678 R131L probably damaging Het
Raph1 A T 1: 60,525,977 V117D probably benign Het
Sacs T C 14: 61,210,396 V3297A probably damaging Het
Serpine1 C A 5: 137,066,942 A262S probably benign Het
Sgf29 A G 7: 126,672,049 D193G probably null Het
Sipa1l1 T C 12: 82,422,462 V1245A possibly damaging Het
Slc22a7 A G 17: 46,438,298 L31P probably damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Slc26a7 A T 4: 14,533,639 Y395N probably damaging Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Susd1 G A 4: 59,411,318 R225* probably null Het
Suz12 T A 11: 79,993,593 F92I probably damaging Het
Tmem114 C A 16: 8,424,746 probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trim45 A G 3: 100,932,037 T752A unknown Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Vmn2r39 T G 7: 9,014,762 K858N possibly damaging Het
Zfp629 A T 7: 127,611,312 S442T probably damaging Het
Other mutations in Tmem68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Tmem68 APN 4 3560536 missense probably damaging 1.00
IGL02433:Tmem68 APN 4 3569624 missense possibly damaging 0.79
IGL02537:Tmem68 APN 4 3569649 missense possibly damaging 0.95
IGL02886:Tmem68 APN 4 3569361 splice site probably benign
R0600:Tmem68 UTSW 4 3569667 missense probably damaging 0.99
R1670:Tmem68 UTSW 4 3560627 missense probably damaging 0.99
R3001:Tmem68 UTSW 4 3569588 missense probably damaging 1.00
R3002:Tmem68 UTSW 4 3569588 missense probably damaging 1.00
R3086:Tmem68 UTSW 4 3569594 missense possibly damaging 0.95
R4428:Tmem68 UTSW 4 3569534 missense probably benign 0.33
R5221:Tmem68 UTSW 4 3560561 missense possibly damaging 0.83
R5640:Tmem68 UTSW 4 3569512 missense probably benign
R6919:Tmem68 UTSW 4 3569669 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CTCAAGGTGAGTTTAGGCAATAGAG -3'
(R):5'- TCTGTCCTGCCGTATGATTG -3'

Sequencing Primer
(F):5'- CAAAAAGTAGGTGACATTTTTGGC -3'
(R):5'- GTCCTGCCGTATGATTGTAGAACC -3'
Posted On2019-05-15