Incidental Mutation 'R7123:1700014D04Rik'
ID552156
Institutional Source Beutler Lab
Gene Symbol 1700014D04Rik
Ensembl Gene ENSMUSG00000051054
Gene NameRIKEN cDNA 1700014D04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7123 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59740842-59746752 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 59743440 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 189 (Q189*)
Ref Sequence ENSEMBL: ENSMUSP00000136424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055343] [ENSMUST00000178508] [ENSMUST00000180139]
Predicted Effect probably benign
Transcript: ENSMUST00000055343
SMART Domains Protein: ENSMUSP00000052403
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178508
SMART Domains Protein: ENSMUSP00000136897
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
Pfam:FAM75 66 99 7.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180139
AA Change: Q189*
SMART Domains Protein: ENSMUSP00000136424
Gene: ENSMUSG00000051054
AA Change: Q189*

DomainStartEndE-ValueType
Pfam:FAM75 66 439 6.9e-97 PFAM
low complexity region 622 633 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
low complexity region 737 763 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,265,975 I1521T probably damaging Het
Adgrv1 A T 13: 81,592,574 I145N probably damaging Het
Ago3 C A 4: 126,355,005 probably null Het
Agrn A T 4: 156,172,840 W1178R probably benign Het
Akap3 A T 6: 126,866,304 I629L probably benign Het
Aknad1 T G 3: 108,775,244 Y545* probably null Het
Anapc1 C A 2: 128,613,010 V1925F probably damaging Het
Barhl1 C T 2: 28,909,931 probably null Het
Cfap157 T C 2: 32,779,401 E294G probably damaging Het
Cfd G A 10: 79,892,497 G231S probably damaging Het
Csf2ra A G 19: 61,226,862 V105A probably damaging Het
Dhtkd1 A T 2: 5,917,780 W523R probably damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc22 A C 15: 99,101,204 Y90S possibly damaging Het
Ebna1bp2 A G 4: 118,625,575 K254E probably damaging Het
Gfpt1 A T 6: 87,056,186 D131V probably damaging Het
Gm5460 A G 14: 34,042,025 I21V unknown Het
Gm7030 A G 17: 36,127,794 I235T possibly damaging Het
Htr1d C T 4: 136,442,353 probably benign Het
Kndc1 G A 7: 139,936,836 E1570K probably damaging Het
Kntc1 T C 5: 123,781,726 Y887H probably damaging Het
Kti12 T C 4: 108,848,482 S198P probably benign Het
Mcmdc2 A T 1: 9,940,418 I604F unknown Het
Mmp8 A T 9: 7,563,195 D253V probably damaging Het
Muc4 T C 16: 32,750,691 S252P possibly damaging Het
Myo5c A G 9: 75,289,223 K1317R probably benign Het
Ncoa7 T C 10: 30,654,439 I749V probably benign Het
Nfrkb A G 9: 31,414,015 probably null Het
Obscn T C 11: 59,013,651 T7166A probably benign Het
Obsl1 A G 1: 75,489,669 S1472P probably damaging Het
Olfr128 T A 17: 37,923,676 L37M probably benign Het
Olfr379-ps1 T A 11: 73,433,710 D172V unknown Het
Orc1 A C 4: 108,588,687 M1L probably damaging Het
Pkd1 T A 17: 24,594,768 S4069T possibly damaging Het
Pus1 T C 5: 110,773,932 *442W probably null Het
Rgma A C 7: 73,409,391 D97A probably damaging Het
Ryr1 T C 7: 29,046,854 K3834E probably benign Het
Sars2 T C 7: 28,753,441 V475A probably benign Het
Scamp2 A T 9: 57,587,102 T253S probably benign Het
Skint9 C T 4: 112,390,977 W190* probably null Het
Sv2b C T 7: 75,117,702 V649I possibly damaging Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tiparp A T 3: 65,553,527 I646F probably damaging Het
Topaz1 G A 9: 122,748,415 G130D probably damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Ttll7 C T 3: 146,913,296 P319S possibly damaging Het
Umodl1 T A 17: 30,982,344 F416I possibly damaging Het
Vmn2r104 T C 17: 20,040,826 D445G probably benign Het
Wnk2 A G 13: 49,081,986 V651A possibly damaging Het
Zbtb21 C T 16: 97,949,912 S1057N probably damaging Het
Zfp451 A T 1: 33,776,869 C667S probably damaging Het
Other mutations in 1700014D04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0838:1700014D04Rik UTSW 13 59742468 missense possibly damaging 0.75
R1483:1700014D04Rik UTSW 13 59742903 missense probably damaging 0.99
R1794:1700014D04Rik UTSW 13 59742620 missense probably benign 0.22
R1842:1700014D04Rik UTSW 13 59742506 missense probably damaging 1.00
R1969:1700014D04Rik UTSW 13 59742785 missense probably damaging 0.98
R2027:1700014D04Rik UTSW 13 59742587 missense possibly damaging 0.48
R2206:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2207:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2882:1700014D04Rik UTSW 13 59742943 missense probably benign 0.00
R3508:1700014D04Rik UTSW 13 59742505 nonsense probably null
R4447:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R4560:1700014D04Rik UTSW 13 59741757 missense probably damaging 1.00
R4846:1700014D04Rik UTSW 13 59742233 missense probably benign 0.00
R5186:1700014D04Rik UTSW 13 59743739 missense probably damaging 1.00
R5510:1700014D04Rik UTSW 13 59742420 unclassified probably null
R5580:1700014D04Rik UTSW 13 59742256 missense probably benign 0.00
R5752:1700014D04Rik UTSW 13 59743202 missense probably damaging 0.96
R6266:1700014D04Rik UTSW 13 59742312 missense probably benign 0.33
R6267:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6296:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6939:1700014D04Rik UTSW 13 59742058 missense possibly damaging 0.75
R6973:1700014D04Rik UTSW 13 59742707 missense probably benign 0.14
R7107:1700014D04Rik UTSW 13 59742183 nonsense probably null
R7254:1700014D04Rik UTSW 13 59741976 missense probably benign 0.01
R7354:1700014D04Rik UTSW 13 59741834 nonsense probably null
R7536:1700014D04Rik UTSW 13 59741742 missense probably damaging 0.99
X0024:1700014D04Rik UTSW 13 59742725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGTTGTTCTGATGTTCAC -3'
(R):5'- AGTGCTGAGTCATGGTCTTCC -3'

Sequencing Primer
(F):5'- TTCACTGCTGAAATGAAAAAGGCC -3'
(R):5'- GTCTTCCAGCCCTTCCCCAG -3'
Posted On2019-05-15