Incidental Mutation 'R7125:BC055324'
ID552247
Institutional Source Beutler Lab
Gene Symbol BC055324
Ensembl Gene ENSMUSG00000041406
Gene NamecDNA sequence BC055324
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7125 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163945993-163994796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163962062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 635 (T635A)
Ref Sequence ENSEMBL: ENSMUSP00000095101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000159617]
Predicted Effect probably benign
Transcript: ENSMUST00000045876
AA Change: T635A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406
AA Change: T635A

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
AA Change: T635A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406
AA Change: T635A

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159617
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,470 M24V probably benign Het
5730455P16Rik A T 11: 80,364,925 C296S probably damaging Het
Ago3 T C 4: 126,370,352 I354V probably null Het
Aldh1l1 G A 6: 90,576,779 probably null Het
Ankrd49 TAA TA 9: 14,782,540 probably null Het
B3gnt7 A G 1: 86,305,377 Y115C probably damaging Het
Cacna1h A T 17: 25,383,536 M1506K probably damaging Het
Cars T C 7: 143,584,773 T226A probably benign Het
Ccdc28b T A 4: 129,621,092 T75S probably benign Het
Cdc42bpg A G 19: 6,322,291 I1436V probably damaging Het
Cep152 A T 2: 125,566,673 Y1320* probably null Het
Cntnap2 A T 6: 46,988,646 Y797F probably benign Het
Coq8a T A 1: 180,168,801 N490I probably damaging Het
Csmd2 T C 4: 128,496,162 L2230P Het
Cyp4a14 A T 4: 115,491,161 I373N probably damaging Het
Ddx1 A G 12: 13,243,863 S86P probably benign Het
Dennd3 A T 15: 73,533,291 I298F possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah2 T C 11: 69,436,182 T3533A probably damaging Het
Fam53b T C 7: 132,771,628 H27R probably damaging Het
Fyb G A 15: 6,644,856 E658K possibly damaging Het
Gapvd1 T C 2: 34,695,600 S996G probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Golgb1 T A 16: 36,917,963 H2262Q possibly damaging Het
Gpam T C 19: 55,076,335 T646A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hexdc C T 11: 121,204,670 probably benign Het
Micu2 A T 14: 57,971,781 Y73* probably null Het
N4bp2l2 T C 5: 150,650,429 probably null Het
Olfr1466 A T 19: 13,341,739 probably null Het
Olfr24 A T 9: 18,754,878 Y252* probably null Het
Olfr391-ps T C 11: 73,799,164 M198V probably benign Het
Olfr574 T C 7: 102,949,179 V238A probably damaging Het
Olfr746 T C 14: 50,653,584 C116R possibly damaging Het
Prkca A G 11: 107,984,022 Y365H probably damaging Het
Ptpre C T 7: 135,654,015 R155* probably null Het
Ryr2 T A 13: 11,669,987 N3023Y probably damaging Het
S100a7a A G 3: 90,655,515 D3G probably benign Het
Scn2a T C 2: 65,763,933 F1709L probably damaging Het
Slc15a2 T C 16: 36,782,298 E67G probably damaging Het
Slc25a22 A G 7: 141,431,742 L195P probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,644,569 probably benign Het
Stim1 T A 7: 102,435,534 H564Q possibly damaging Het
Sulf2 C T 2: 166,075,528 W855* probably null Het
Tenm3 T C 8: 48,674,553 N30S probably benign Het
Trim59 T C 3: 69,036,864 D381G probably benign Het
Ttc21b T C 2: 66,236,326 T328A probably benign Het
Ttc6 C G 12: 57,576,339 Q175E probably benign Het
Vmn2r44 T C 7: 8,367,942 I702V probably damaging Het
Zfp768 A T 7: 127,344,787 F59L probably damaging Het
Other mutations in BC055324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:BC055324 APN 1 163957522 missense probably benign 0.01
IGL02638:BC055324 APN 1 163959299 nonsense probably null
IGL03337:BC055324 APN 1 163990759 missense probably damaging 0.96
IGL03048:BC055324 UTSW 1 163964525 missense probably benign 0.04
R0106:BC055324 UTSW 1 163982811 unclassified probably benign
R0106:BC055324 UTSW 1 163982811 unclassified probably benign
R0414:BC055324 UTSW 1 163968321 missense probably benign 0.02
R0511:BC055324 UTSW 1 163971843 splice site probably null
R1323:BC055324 UTSW 1 163955461 unclassified probably benign
R1870:BC055324 UTSW 1 163964794 missense probably damaging 1.00
R2129:BC055324 UTSW 1 163966457 missense probably damaging 1.00
R3716:BC055324 UTSW 1 163956888 missense probably damaging 1.00
R3783:BC055324 UTSW 1 163987683 missense probably benign 0.27
R3872:BC055324 UTSW 1 163986964 missense probably damaging 0.99
R4427:BC055324 UTSW 1 163954284 missense probably benign
R5069:BC055324 UTSW 1 163987674 missense possibly damaging 0.59
R5620:BC055324 UTSW 1 163962044 nonsense probably null
R5681:BC055324 UTSW 1 163962085 missense probably damaging 1.00
R5699:BC055324 UTSW 1 163957551 missense probably benign 0.26
R5936:BC055324 UTSW 1 163987012 missense probably benign 0.00
R6065:BC055324 UTSW 1 163959388 missense probably benign 0.08
R6065:BC055324 UTSW 1 163987688 missense probably damaging 1.00
R6075:BC055324 UTSW 1 163978087 missense probably damaging 1.00
R6466:BC055324 UTSW 1 163954165 missense probably benign 0.01
R6701:BC055324 UTSW 1 163971843 splice site probably null
R6776:BC055324 UTSW 1 163976749 missense probably damaging 1.00
R6851:BC055324 UTSW 1 163964767 missense probably damaging 1.00
R6923:BC055324 UTSW 1 163986885 critical splice donor site probably null
R7361:BC055324 UTSW 1 163986033 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GTGACTGACACTTTGGTAAGGTCTAC -3'
(R):5'- GACATCGTATGTACAGAGCCTAG -3'

Sequencing Primer
(F):5'- AGTCAGTAACTGCCTGATGC -3'
(R):5'- CGTATGTACAGAGCCTAGTAAAATTC -3'
Posted On2019-05-15