Incidental Mutation 'R7125:Slc25a22'
ID552270
Institutional Source Beutler Lab
Gene Symbol Slc25a22
Ensembl Gene ENSMUSG00000019082
Gene Namesolute carrier family 25 (mitochondrial carrier, glutamate), member 22
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7125 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141429744-141437892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141431742 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 195 (L195P)
Ref Sequence ENSEMBL: ENSMUSP00000019226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000084436] [ENSMUST00000106006] [ENSMUST00000106007] [ENSMUST00000124266] [ENSMUST00000124444] [ENSMUST00000133021] [ENSMUST00000133206] [ENSMUST00000136354] [ENSMUST00000137488] [ENSMUST00000138865] [ENSMUST00000150026] [ENSMUST00000164387] [ENSMUST00000172654] [ENSMUST00000174095] [ENSMUST00000184518] [ENSMUST00000201127] [ENSMUST00000201710] [ENSMUST00000201822] [ENSMUST00000202840]
Predicted Effect probably damaging
Transcript: ENSMUST00000019226
AA Change: L195P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082
AA Change: L195P

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 8.1e-26 PFAM
Pfam:Mito_carr 99 217 8.6e-19 PFAM
Pfam:Mito_carr 221 310 7.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084436
SMART Domains Protein: ENSMUSP00000081476
Gene: ENSMUSG00000060240

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106006
SMART Domains Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.8e-26 PFAM
Pfam:Mito_carr 99 137 5.6e-8 PFAM
Pfam:Mito_carr 134 216 2.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106007
AA Change: L195P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101629
Gene: ENSMUSG00000019082
AA Change: L195P

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124266
SMART Domains Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124444
SMART Domains Protein: ENSMUSP00000118591
Gene: ENSMUSG00000060240

DomainStartEndE-ValueType
Pfam:CEND1 1 149 1.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133021
Predicted Effect probably benign
Transcript: ENSMUST00000133206
Predicted Effect probably damaging
Transcript: ENSMUST00000136354
AA Change: L195P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118948
Gene: ENSMUSG00000019082
AA Change: L195P

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.2e-25 PFAM
Pfam:Mito_carr 99 206 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137488
SMART Domains Protein: ENSMUSP00000123334
Gene: ENSMUSG00000060240

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138865
AA Change: L195P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120721
Gene: ENSMUSG00000019082
AA Change: L195P

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.4e-25 PFAM
Pfam:Mito_carr 99 214 1.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150026
Predicted Effect probably benign
Transcript: ENSMUST00000153190
Predicted Effect probably benign
Transcript: ENSMUST00000164387
SMART Domains Protein: ENSMUSP00000131085
Gene: ENSMUSG00000060240

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172654
SMART Domains Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 1 54 6.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174095
Predicted Effect probably benign
Transcript: ENSMUST00000184518
SMART Domains Protein: ENSMUSP00000138924
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201127
AA Change: L191P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000201710
AA Change: L195P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082
AA Change: L195P

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201822
SMART Domains Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 70 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202840
SMART Domains Protein: ENSMUSP00000144384
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 85 5.6e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial glutamate carrier. Mutations in this gene are associated with early infantile epileptic encephalopathy. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,470 M24V probably benign Het
5730455P16Rik A T 11: 80,364,925 C296S probably damaging Het
Ago3 T C 4: 126,370,352 I354V probably null Het
Aldh1l1 G A 6: 90,576,779 probably null Het
Ankrd49 TAA TA 9: 14,782,540 probably null Het
B3gnt7 A G 1: 86,305,377 Y115C probably damaging Het
BC055324 T C 1: 163,962,062 T635A probably benign Het
Cacna1h A T 17: 25,383,536 M1506K probably damaging Het
Cars T C 7: 143,584,773 T226A probably benign Het
Ccdc28b T A 4: 129,621,092 T75S probably benign Het
Cdc42bpg A G 19: 6,322,291 I1436V probably damaging Het
Cep152 A T 2: 125,566,673 Y1320* probably null Het
Cntnap2 A T 6: 46,988,646 Y797F probably benign Het
Coq8a T A 1: 180,168,801 N490I probably damaging Het
Csmd2 T C 4: 128,496,162 L2230P Het
Cyp4a14 A T 4: 115,491,161 I373N probably damaging Het
Ddx1 A G 12: 13,243,863 S86P probably benign Het
Dennd3 A T 15: 73,533,291 I298F possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah2 T C 11: 69,436,182 T3533A probably damaging Het
Fam53b T C 7: 132,771,628 H27R probably damaging Het
Fyb G A 15: 6,644,856 E658K possibly damaging Het
Gapvd1 T C 2: 34,695,600 S996G probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm47995 G C 1: 151,198,650 R68P probably benign Het
Golgb1 T A 16: 36,917,963 H2262Q possibly damaging Het
Gpam T C 19: 55,076,335 T646A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hexdc C T 11: 121,204,670 probably benign Het
Micu2 A T 14: 57,971,781 Y73* probably null Het
Olfr1466 A T 19: 13,341,739 probably null Het
Olfr24 A T 9: 18,754,878 Y252* probably null Het
Olfr391-ps T C 11: 73,799,164 M198V probably benign Het
Olfr574 T C 7: 102,949,179 V238A probably damaging Het
Olfr746 T C 14: 50,653,584 C116R possibly damaging Het
Prkca A G 11: 107,984,022 Y365H probably damaging Het
Ptpre C T 7: 135,654,015 R155* probably null Het
Ryr2 T A 13: 11,669,987 N3023Y probably damaging Het
S100a7a A G 3: 90,655,515 D3G probably benign Het
Scn2a T C 2: 65,763,933 F1709L probably damaging Het
Slc15a2 T C 16: 36,782,298 E67G probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,644,569 probably benign Het
Stim1 T A 7: 102,435,534 H564Q possibly damaging Het
Sulf2 C T 2: 166,075,528 W855* probably null Het
Tenm3 T C 8: 48,674,553 N30S probably benign Het
Trim59 T C 3: 69,036,864 D381G probably benign Het
Ttc21b T C 2: 66,236,326 T328A probably benign Het
Ttc6 C G 12: 57,576,339 Q175E probably benign Het
Vmn2r44 T C 7: 8,367,942 I702V probably damaging Het
Zfp768 A T 7: 127,344,787 F59L probably damaging Het
Other mutations in Slc25a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0579:Slc25a22 UTSW 7 141431359 missense probably damaging 1.00
R5234:Slc25a22 UTSW 7 141434203 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACCATCACAAGGGTTGACG -3'
(R):5'- CTCAGAGGAAGATTCTGGCTG -3'

Sequencing Primer
(F):5'- CAGCCTGCTAGGAAGGACAC -3'
(R):5'- TGCCCAGGCTCAGCTCTC -3'
Posted On2019-05-15