Incidental Mutation 'R7125:Hexdc'
ID552280
Institutional Source Beutler Lab
Gene Symbol Hexdc
Ensembl Gene ENSMUSG00000039307
Gene Namehexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7125 (G1)
Quality Score108.008
Status Not validated
Chromosome11
Chromosomal Location121204433-121222655 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 121204670 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026169] [ENSMUST00000038831] [ENSMUST00000106117] [ENSMUST00000124768]
Predicted Effect probably benign
Transcript: ENSMUST00000026169
SMART Domains Protein: ENSMUSP00000026169
Gene: ENSMUSG00000025169

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
P4Hc 104 302 1.82e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038831
SMART Domains Protein: ENSMUSP00000048479
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 30 223 2.9e-12 PFAM
low complexity region 528 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106117
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124768
SMART Domains Protein: ENSMUSP00000122008
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 22 152 8.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151495
SMART Domains Protein: ENSMUSP00000123073
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 27 220 3.1e-12 PFAM
low complexity region 525 535 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,470 M24V probably benign Het
5730455P16Rik A T 11: 80,364,925 C296S probably damaging Het
Ago3 T C 4: 126,370,352 I354V probably null Het
Aldh1l1 G A 6: 90,576,779 probably null Het
Ankrd49 TAA TA 9: 14,782,540 probably null Het
B3gnt7 A G 1: 86,305,377 Y115C probably damaging Het
BC055324 T C 1: 163,962,062 T635A probably benign Het
Cacna1h A T 17: 25,383,536 M1506K probably damaging Het
Cars T C 7: 143,584,773 T226A probably benign Het
Ccdc28b T A 4: 129,621,092 T75S probably benign Het
Cdc42bpg A G 19: 6,322,291 I1436V probably damaging Het
Cep152 A T 2: 125,566,673 Y1320* probably null Het
Cntnap2 A T 6: 46,988,646 Y797F probably benign Het
Coq8a T A 1: 180,168,801 N490I probably damaging Het
Csmd2 T C 4: 128,496,162 L2230P Het
Cyp4a14 A T 4: 115,491,161 I373N probably damaging Het
Ddx1 A G 12: 13,243,863 S86P probably benign Het
Dennd3 A T 15: 73,533,291 I298F possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah2 T C 11: 69,436,182 T3533A probably damaging Het
Fam53b T C 7: 132,771,628 H27R probably damaging Het
Fyb G A 15: 6,644,856 E658K possibly damaging Het
Gapvd1 T C 2: 34,695,600 S996G probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm47995 G C 1: 151,198,650 R68P probably benign Het
Golgb1 T A 16: 36,917,963 H2262Q possibly damaging Het
Gpam T C 19: 55,076,335 T646A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Micu2 A T 14: 57,971,781 Y73* probably null Het
Olfr1466 A T 19: 13,341,739 probably null Het
Olfr24 A T 9: 18,754,878 Y252* probably null Het
Olfr391-ps T C 11: 73,799,164 M198V probably benign Het
Olfr574 T C 7: 102,949,179 V238A probably damaging Het
Olfr746 T C 14: 50,653,584 C116R possibly damaging Het
Prkca A G 11: 107,984,022 Y365H probably damaging Het
Ptpre C T 7: 135,654,015 R155* probably null Het
Ryr2 T A 13: 11,669,987 N3023Y probably damaging Het
S100a7a A G 3: 90,655,515 D3G probably benign Het
Scn2a T C 2: 65,763,933 F1709L probably damaging Het
Slc15a2 T C 16: 36,782,298 E67G probably damaging Het
Slc25a22 A G 7: 141,431,742 L195P probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,644,569 probably benign Het
Stim1 T A 7: 102,435,534 H564Q possibly damaging Het
Sulf2 C T 2: 166,075,528 W855* probably null Het
Tenm3 T C 8: 48,674,553 N30S probably benign Het
Trim59 T C 3: 69,036,864 D381G probably benign Het
Ttc21b T C 2: 66,236,326 T328A probably benign Het
Ttc6 C G 12: 57,576,339 Q175E probably benign Het
Vmn2r44 T C 7: 8,367,942 I702V probably damaging Het
Zfp768 A T 7: 127,344,787 F59L probably damaging Het
Other mutations in Hexdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Hexdc APN 11 121221160 missense probably benign 0.35
IGL01981:Hexdc APN 11 121216993 missense possibly damaging 0.93
R0360:Hexdc UTSW 11 121212143 missense probably benign 0.18
R0364:Hexdc UTSW 11 121212143 missense probably benign 0.18
R0376:Hexdc UTSW 11 121218165 splice site probably benign
R1148:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1148:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1493:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1883:Hexdc UTSW 11 121207698 missense probably benign 0.00
R4021:Hexdc UTSW 11 121218161 critical splice donor site probably null
R4163:Hexdc UTSW 11 121221149 missense probably benign 0.01
R4939:Hexdc UTSW 11 121207716 missense probably benign
R5308:Hexdc UTSW 11 121222269 missense probably damaging 1.00
R5716:Hexdc UTSW 11 121221562 missense probably benign 0.03
R6127:Hexdc UTSW 11 121216999 missense possibly damaging 0.89
R6154:Hexdc UTSW 11 121221271 missense probably benign 0.02
R6921:Hexdc UTSW 11 121222281 missense probably damaging 0.98
R6928:Hexdc UTSW 11 121212054 missense possibly damaging 0.82
R6939:Hexdc UTSW 11 121222338 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAATCAAGACCACGCTCTG -3'
(R):5'- AGGCTTCTCAATGCAGCTCTC -3'

Sequencing Primer
(F):5'- TAAGGATCCCGCTACCTGGTC -3'
(R):5'- CGTAGGAGACAGGTCATCCG -3'
Posted On2019-05-15