Incidental Mutation 'R7125:Cdc42bpg'
ID552291
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R7125 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6322291 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1436 (I1436V)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: I1436V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: I1436V

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,470 M24V probably benign Het
5730455P16Rik A T 11: 80,364,925 C296S probably damaging Het
Ago3 T C 4: 126,370,352 I354V probably null Het
Aldh1l1 G A 6: 90,576,779 probably null Het
Ankrd49 TAA TA 9: 14,782,540 probably null Het
B3gnt7 A G 1: 86,305,377 Y115C probably damaging Het
BC055324 T C 1: 163,962,062 T635A probably benign Het
Cacna1h A T 17: 25,383,536 M1506K probably damaging Het
Cars T C 7: 143,584,773 T226A probably benign Het
Ccdc28b T A 4: 129,621,092 T75S probably benign Het
Cep152 A T 2: 125,566,673 Y1320* probably null Het
Cntnap2 A T 6: 46,988,646 Y797F probably benign Het
Coq8a T A 1: 180,168,801 N490I probably damaging Het
Csmd2 T C 4: 128,496,162 L2230P Het
Cyp4a14 A T 4: 115,491,161 I373N probably damaging Het
Ddx1 A G 12: 13,243,863 S86P probably benign Het
Dennd3 A T 15: 73,533,291 I298F possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah2 T C 11: 69,436,182 T3533A probably damaging Het
Fam53b T C 7: 132,771,628 H27R probably damaging Het
Fyb G A 15: 6,644,856 E658K possibly damaging Het
Gapvd1 T C 2: 34,695,600 S996G probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm47995 G C 1: 151,198,650 R68P probably benign Het
Golgb1 T A 16: 36,917,963 H2262Q possibly damaging Het
Gpam T C 19: 55,076,335 T646A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hexdc C T 11: 121,204,670 probably benign Het
Micu2 A T 14: 57,971,781 Y73* probably null Het
Olfr1466 A T 19: 13,341,739 probably null Het
Olfr24 A T 9: 18,754,878 Y252* probably null Het
Olfr391-ps T C 11: 73,799,164 M198V probably benign Het
Olfr574 T C 7: 102,949,179 V238A probably damaging Het
Olfr746 T C 14: 50,653,584 C116R possibly damaging Het
Prkca A G 11: 107,984,022 Y365H probably damaging Het
Ptpre C T 7: 135,654,015 R155* probably null Het
Ryr2 T A 13: 11,669,987 N3023Y probably damaging Het
S100a7a A G 3: 90,655,515 D3G probably benign Het
Scn2a T C 2: 65,763,933 F1709L probably damaging Het
Slc15a2 T C 16: 36,782,298 E67G probably damaging Het
Slc25a22 A G 7: 141,431,742 L195P probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,644,569 probably benign Het
Stim1 T A 7: 102,435,534 H564Q possibly damaging Het
Sulf2 C T 2: 166,075,528 W855* probably null Het
Tenm3 T C 8: 48,674,553 N30S probably benign Het
Trim59 T C 3: 69,036,864 D381G probably benign Het
Ttc21b T C 2: 66,236,326 T328A probably benign Het
Ttc6 C G 12: 57,576,339 Q175E probably benign Het
Vmn2r44 T C 7: 8,367,942 I702V probably damaging Het
Zfp768 A T 7: 127,344,787 F59L probably damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGTCTGATGAGCTGCGACAG -3'
(R):5'- TCAGACCATGGGAACTCAGC -3'

Sequencing Primer
(F):5'- CTGGGTGGGACTTTCTATTC -3'
(R):5'- ACTCAGCTACTGGCAATGAGGTC -3'
Posted On2019-05-15