Incidental Mutation 'R7126:Grid2'
ID552320
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7126 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64076810 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 331 (V331E)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
Predicted Effect probably damaging
Transcript: ENSMUST00000095852
AA Change: V331E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: V331E

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,720,564 V8I probably benign Het
1810062G17Rik T C 3: 36,481,839 C85R unknown Het
3110082I17Rik G T 5: 139,361,250 H153Q unknown Het
Acadsb T C 7: 131,437,448 I316T probably benign Het
Acsbg2 A T 17: 56,846,633 N523K probably damaging Het
Ahnak C T 19: 9,002,359 P336S possibly damaging Het
Ankdd1b A G 13: 96,429,862 V277A possibly damaging Het
Aspm A G 1: 139,480,803 Y2476C probably benign Het
Atg13 G A 2: 91,680,420 R321W probably damaging Het
B4galt2 A G 4: 117,877,538 F211S probably damaging Het
Baiap3 T A 17: 25,245,145 T913S possibly damaging Het
Btbd18 A T 2: 84,666,202 E61D possibly damaging Het
Btnl9 G T 11: 49,169,255 S555R probably damaging Het
Cbs T A 17: 31,619,139 M379L probably benign Het
Chd9 G A 8: 91,015,225 G1614D unknown Het
Cmya5 G A 13: 93,089,940 P2880L probably benign Het
Cnnm1 T C 19: 43,484,853 S729P probably damaging Het
Cox16 T A 12: 81,472,166 E70D probably benign Het
Cp A G 3: 19,980,624 H699R probably damaging Het
Cyp2d26 T C 15: 82,794,008 N56D probably benign Het
Dennd4c A G 4: 86,807,430 Y707C probably damaging Het
Dgcr14 T C 16: 17,911,290 T6A unknown Het
Dnah5 A T 15: 28,349,837 E2555D probably benign Het
Filip1 A G 9: 79,898,295 L59P possibly damaging Het
Fsip2 A G 2: 82,983,141 N3268S possibly damaging Het
Gja10 A T 4: 32,601,014 C457S probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm4779 GGG GGGCCCGG X: 101,794,173 probably null Het
Gm4779 GGGGCC GGGGCCCGGGCC X: 101,794,185 probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm4869 A T 5: 140,491,318 D874V probably benign Het
Inpp4a C A 1: 37,374,272 H123Q probably benign Het
Ireb2 T A 9: 54,886,567 Y260* probably null Het
Itpr2 G A 6: 146,357,796 Q628* probably null Het
Kbtbd11 G A 8: 15,028,759 A453T probably damaging Het
Kcnj2 A G 11: 111,072,822 T347A probably damaging Het
Klhl12 A G 1: 134,467,783 H161R probably damaging Het
Krt78 T C 15: 101,948,436 E412G probably damaging Het
Lzic A G 4: 149,488,675 I95V probably damaging Het
Mme C T 3: 63,368,901 P700S probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mthfd2 A G 6: 83,313,490 V53A probably benign Het
Mtus1 A G 8: 41,015,402 L210P probably damaging Het
Muc16 T C 9: 18,641,216 T4594A probably benign Het
Olfm5 A T 7: 104,159,980 C208S probably damaging Het
Olfr1355 T C 10: 78,879,577 V135A possibly damaging Het
Olfr1368 A T 13: 21,142,718 L113H probably damaging Het
Olfr1494 T A 19: 13,749,523 I139N possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Prl7a1 C T 13: 27,642,419 probably null Het
Ptpn23 T C 9: 110,388,744 D711G probably benign Het
Rgs22 A T 15: 36,103,808 I169N probably damaging Het
Scn7a G T 2: 66,757,286 H24Q possibly damaging Het
Scrt2 C T 2: 152,093,086 P53L probably damaging Het
Sh3rf1 A T 8: 61,349,424 I264L probably benign Het
Smarcd1 A T 15: 99,709,325 D393V probably damaging Het
Spag17 T G 3: 100,101,435 N1960K probably benign Het
Ssb A G 2: 69,866,501 T62A possibly damaging Het
Taar7b T A 10: 24,000,062 Y42N possibly damaging Het
Terf1 A T 1: 15,813,139 I159L probably benign Het
Tff3 T G 17: 31,127,436 N54T probably benign Het
Top2a A G 11: 99,014,992 L285P probably benign Het
Trim24 A G 6: 37,919,457 Y283C probably damaging Het
Trim58 T C 11: 58,640,579 C38R probably damaging Het
Trpa1 T A 1: 14,890,424 T647S probably benign Het
Trpm6 C T 19: 18,854,033 Q1421* probably null Het
Vmn1r46 T G 6: 89,976,994 I275S possibly damaging Het
Vmn2r54 A G 7: 12,632,161 F282S possibly damaging Het
Vmn2r57 A G 7: 41,399,794 S844P possibly damaging Het
Vps13a A C 19: 16,710,879 C855G probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGTGGTAGAACTAGCTAAGGAATG -3'
(R):5'- AGTCTGAGTTTGCAGCATTGTC -3'

Sequencing Primer
(F):5'- TGAAAAGAAAAATGTCCTGCCTAG -3'
(R):5'- CAGCTTTGCGTGCCAATG -3'
Posted On2019-05-15