Incidental Mutation 'R7127:2810474O19Rik'
ID552389
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7127 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149327945 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 830 (F830L)
Ref Sequence ENSEMBL: ENSMUSP00000041180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046689
AA Change: F830L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: F830L

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100765
AA Change: F830L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: F830L

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably benign
Transcript: ENSMUST00000130664
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect possibly damaging
Transcript: ENSMUST00000189837
AA Change: F830L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: F830L

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189932
AA Change: F830L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: F830L

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190785
AA Change: F830L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: F830L

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C T 7: 120,332,602 T26I probably benign Het
Adam5 A T 8: 24,810,781 I244N probably damaging Het
Adam7 A G 14: 68,514,769 probably null Het
Aox4 T A 1: 58,228,874 N204K probably benign Het
Arl13b C T 16: 62,801,739 G397D probably damaging Het
AU041133 T C 10: 82,150,866 F118L probably benign Het
Brinp1 C T 4: 68,793,023 R316H probably benign Het
Cabcoco1 C T 10: 68,436,330 V268I probably benign Het
Car15 T C 16: 17,838,196 probably benign Het
Ccdc185 G T 1: 182,748,856 D89E possibly damaging Het
Cckar T A 5: 53,706,475 Y48F probably damaging Het
Cdyl T A 13: 35,856,668 S282T probably benign Het
Clca1 T C 3: 145,006,045 T730A probably damaging Het
Cracr2b T C 7: 141,465,782 S318P possibly damaging Het
Depdc1b T C 13: 108,323,928 F24S probably damaging Het
Duox2 C T 2: 122,291,949 G565D probably benign Het
Ehbp1 A T 11: 22,053,529 Y1073* probably null Het
Epg5 A T 18: 78,028,925 N2384I probably damaging Het
Fam171b A G 2: 83,879,766 D594G probably benign Het
Flad1 A G 3: 89,403,418 Y441H probably damaging Het
Fn1 T C 1: 71,597,544 T2150A probably benign Het
Fnta C A 8: 26,007,203 R206L probably damaging Het
Gadd45b A T 10: 80,931,165 M95L probably benign Het
Gbp8 A T 5: 105,017,712 H358Q probably benign Het
Glipr1l3 C A 10: 112,148,090 G157V probably damaging Het
Hoxc13 T C 15: 102,921,468 I94T possibly damaging Het
Hunk A G 16: 90,475,891 D361G probably damaging Het
Igkv3-4 T A 6: 70,672,171 Y51* probably null Het
Kif26a C T 12: 112,178,145 P1611L probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lrrc8d T C 5: 105,812,963 V413A probably damaging Het
Med6 C T 12: 81,589,000 R86Q probably damaging Het
Myrf A T 19: 10,215,341 S605T probably benign Het
Olfr792 T A 10: 129,541,067 C177S probably damaging Het
Plk3 A T 4: 117,130,570 V429E probably benign Het
Plrg1 C T 3: 83,059,915 P131L probably damaging Het
Plscr4 C T 9: 92,490,778 R318* probably null Het
Rab34 A T 11: 78,191,230 K152* probably null Het
Rasef A T 4: 73,744,132 S194T probably damaging Het
Rcc1 A G 4: 132,334,796 S269P probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scin A G 12: 40,105,072 I174T possibly damaging Het
Serpinb8 A G 1: 107,597,470 M1V probably null Het
Smok3c A T 5: 138,064,709 I153F probably damaging Het
Spen G A 4: 141,476,108 S1736L possibly damaging Het
Sspo T A 6: 48,449,512 M155K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sun2 T C 15: 79,727,899 I528M probably benign Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Taok2 G T 7: 126,867,154 A831E possibly damaging Het
Tas2r126 T C 6: 42,434,805 F91L probably damaging Het
Tas2r140 A G 6: 133,054,959 S279P possibly damaging Het
Tiam1 A T 16: 89,860,260 L696H probably damaging Het
Trank1 T G 9: 111,365,796 S963A possibly damaging Het
Trf A G 9: 103,225,127 V184A probably benign Het
Ttll13 T A 7: 80,253,658 M231K possibly damaging Het
Tuba1a T G 15: 98,951,574 T41P probably benign Het
Zfhx4 A G 3: 5,413,044 Q3573R probably damaging Het
Zfp141 G A 7: 42,475,429 H540Y probably damaging Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTAGGGAGTACACTGGTAG -3'
(R):5'- TTCCGCCAACTTGTCACAGG -3'

Sequencing Primer
(F):5'- CTGTAGGGAGTACACTGGTAGAAAAG -3'
(R):5'- AACTTGTCACAGGGCTGATC -3'
Posted On2019-05-15