Incidental Mutation 'R7127:Zfp141'
ID552390
Institutional Source Beutler Lab
Gene Symbol Zfp141
Ensembl Gene ENSMUSG00000092416
Gene Namezinc finger protein 141
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7127 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location42473386-42505740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42475429 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 540 (H540Y)
Ref Sequence ENSEMBL: ENSMUSP00000133899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173489] [ENSMUST00000174407]
Predicted Effect probably benign
Transcript: ENSMUST00000173489
Predicted Effect probably damaging
Transcript: ENSMUST00000174407
AA Change: H540Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133899
Gene: ENSMUSG00000092416
AA Change: H540Y

DomainStartEndE-ValueType
KRAB 18 78 4.41e-34 SMART
internal_repeat_1 146 405 8.73e-7 PROSPERO
ZnF_C2H2 410 432 4.54e-4 SMART
ZnF_C2H2 438 460 2.2e-2 SMART
ZnF_C2H2 466 488 2.95e-3 SMART
ZnF_C2H2 494 516 4.24e-4 SMART
ZnF_C2H2 522 544 9.58e-3 SMART
ZnF_C2H2 550 572 4.01e-5 SMART
ZnF_C2H2 578 600 3.21e-4 SMART
ZnF_C2H2 606 628 4.87e-4 SMART
ZnF_C2H2 634 656 5.99e-4 SMART
ZnF_C2H2 662 684 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in abnormal skin pigmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,945 F830L possibly damaging Het
Abca15 C T 7: 120,332,602 T26I probably benign Het
Adam5 A T 8: 24,810,781 I244N probably damaging Het
Adam7 A G 14: 68,514,769 probably null Het
Aox4 T A 1: 58,228,874 N204K probably benign Het
Arl13b C T 16: 62,801,739 G397D probably damaging Het
AU041133 T C 10: 82,150,866 F118L probably benign Het
Brinp1 C T 4: 68,793,023 R316H probably benign Het
Cabcoco1 C T 10: 68,436,330 V268I probably benign Het
Car15 T C 16: 17,838,196 probably benign Het
Ccdc185 G T 1: 182,748,856 D89E possibly damaging Het
Cckar T A 5: 53,706,475 Y48F probably damaging Het
Cdyl T A 13: 35,856,668 S282T probably benign Het
Clca1 T C 3: 145,006,045 T730A probably damaging Het
Cracr2b T C 7: 141,465,782 S318P possibly damaging Het
Depdc1b T C 13: 108,323,928 F24S probably damaging Het
Duox2 C T 2: 122,291,949 G565D probably benign Het
Ehbp1 A T 11: 22,053,529 Y1073* probably null Het
Epg5 A T 18: 78,028,925 N2384I probably damaging Het
Fam171b A G 2: 83,879,766 D594G probably benign Het
Flad1 A G 3: 89,403,418 Y441H probably damaging Het
Fn1 T C 1: 71,597,544 T2150A probably benign Het
Fnta C A 8: 26,007,203 R206L probably damaging Het
Gadd45b A T 10: 80,931,165 M95L probably benign Het
Gbp8 A T 5: 105,017,712 H358Q probably benign Het
Glipr1l3 C A 10: 112,148,090 G157V probably damaging Het
Hoxc13 T C 15: 102,921,468 I94T possibly damaging Het
Hunk A G 16: 90,475,891 D361G probably damaging Het
Igkv3-4 T A 6: 70,672,171 Y51* probably null Het
Kif26a C T 12: 112,178,145 P1611L probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lrrc8d T C 5: 105,812,963 V413A probably damaging Het
Med6 C T 12: 81,589,000 R86Q probably damaging Het
Myrf A T 19: 10,215,341 S605T probably benign Het
Olfr792 T A 10: 129,541,067 C177S probably damaging Het
Plk3 A T 4: 117,130,570 V429E probably benign Het
Plrg1 C T 3: 83,059,915 P131L probably damaging Het
Plscr4 C T 9: 92,490,778 R318* probably null Het
Rab34 A T 11: 78,191,230 K152* probably null Het
Rasef A T 4: 73,744,132 S194T probably damaging Het
Rcc1 A G 4: 132,334,796 S269P probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scin A G 12: 40,105,072 I174T possibly damaging Het
Serpinb8 A G 1: 107,597,470 M1V probably null Het
Smok3c A T 5: 138,064,709 I153F probably damaging Het
Spen G A 4: 141,476,108 S1736L possibly damaging Het
Sspo T A 6: 48,449,512 M155K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sun2 T C 15: 79,727,899 I528M probably benign Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Taok2 G T 7: 126,867,154 A831E possibly damaging Het
Tas2r126 T C 6: 42,434,805 F91L probably damaging Het
Tas2r140 A G 6: 133,054,959 S279P possibly damaging Het
Tiam1 A T 16: 89,860,260 L696H probably damaging Het
Trank1 T G 9: 111,365,796 S963A possibly damaging Het
Trf A G 9: 103,225,127 V184A probably benign Het
Ttll13 T A 7: 80,253,658 M231K possibly damaging Het
Tuba1a T G 15: 98,951,574 T41P probably benign Het
Zfhx4 A G 3: 5,413,044 Q3573R probably damaging Het
Other mutations in Zfp141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp141 APN 7 42475307 nonsense probably null
IGL00595:Zfp141 APN 7 42476655 missense probably benign 0.08
R0577:Zfp141 UTSW 7 42476514 missense probably benign 0.14
R0883:Zfp141 UTSW 7 42476056 missense possibly damaging 0.85
R1701:Zfp141 UTSW 7 42476046 missense probably benign 0.35
R2290:Zfp141 UTSW 7 42475225 missense probably damaging 1.00
R4176:Zfp141 UTSW 7 42476281 missense probably benign 0.04
R4719:Zfp141 UTSW 7 42476687 splice site probably null
R4897:Zfp141 UTSW 7 42476205 missense probably benign 0.24
R5372:Zfp141 UTSW 7 42477196 missense possibly damaging 0.91
R5438:Zfp141 UTSW 7 42489470 missense probably damaging 1.00
R5447:Zfp141 UTSW 7 42475559 nonsense probably null
R5743:Zfp141 UTSW 7 42476431 missense possibly damaging 0.68
R5969:Zfp141 UTSW 7 42489488 missense probably damaging 0.98
R6731:Zfp141 UTSW 7 42489500 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTGGGTTTTAAGAGTTGAGCC -3'
(R):5'- TCAGGCTACAGAGAGAATGGT -3'

Sequencing Primer
(F):5'- GTTGAGCCTTCAGTAAAAGACTTGCC -3'
(R):5'- AGAGTGTGGCAAGTCCTTTACTCAC -3'
Posted On2019-05-15