Incidental Mutation 'R7127:Adam5'
ID552396
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7127 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24810781 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 244 (I244N)
Ref Sequence ENSEMBL: ENSMUSP00000052661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably damaging
Transcript: ENSMUST00000050300
AA Change: I244N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: I244N

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118419
AA Change: I244N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: I244N

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: I161N

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209935
AA Change: I244N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,945 F830L possibly damaging Het
Abca15 C T 7: 120,332,602 T26I probably benign Het
Adam7 A G 14: 68,514,769 probably null Het
Aox4 T A 1: 58,228,874 N204K probably benign Het
Arl13b C T 16: 62,801,739 G397D probably damaging Het
AU041133 T C 10: 82,150,866 F118L probably benign Het
Brinp1 C T 4: 68,793,023 R316H probably benign Het
Cabcoco1 C T 10: 68,436,330 V268I probably benign Het
Car15 T C 16: 17,838,196 probably benign Het
Ccdc185 G T 1: 182,748,856 D89E possibly damaging Het
Cckar T A 5: 53,706,475 Y48F probably damaging Het
Cdyl T A 13: 35,856,668 S282T probably benign Het
Clca1 T C 3: 145,006,045 T730A probably damaging Het
Cracr2b T C 7: 141,465,782 S318P possibly damaging Het
Depdc1b T C 13: 108,323,928 F24S probably damaging Het
Duox2 C T 2: 122,291,949 G565D probably benign Het
Ehbp1 A T 11: 22,053,529 Y1073* probably null Het
Epg5 A T 18: 78,028,925 N2384I probably damaging Het
Fam171b A G 2: 83,879,766 D594G probably benign Het
Flad1 A G 3: 89,403,418 Y441H probably damaging Het
Fn1 T C 1: 71,597,544 T2150A probably benign Het
Fnta C A 8: 26,007,203 R206L probably damaging Het
Gadd45b A T 10: 80,931,165 M95L probably benign Het
Gbp8 A T 5: 105,017,712 H358Q probably benign Het
Glipr1l3 C A 10: 112,148,090 G157V probably damaging Het
Hoxc13 T C 15: 102,921,468 I94T possibly damaging Het
Hunk A G 16: 90,475,891 D361G probably damaging Het
Igkv3-4 T A 6: 70,672,171 Y51* probably null Het
Kif26a C T 12: 112,178,145 P1611L probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lrrc8d T C 5: 105,812,963 V413A probably damaging Het
Med6 C T 12: 81,589,000 R86Q probably damaging Het
Myrf A T 19: 10,215,341 S605T probably benign Het
Olfr792 T A 10: 129,541,067 C177S probably damaging Het
Plk3 A T 4: 117,130,570 V429E probably benign Het
Plrg1 C T 3: 83,059,915 P131L probably damaging Het
Plscr4 C T 9: 92,490,778 R318* probably null Het
Rab34 A T 11: 78,191,230 K152* probably null Het
Rasef A T 4: 73,744,132 S194T probably damaging Het
Rcc1 A G 4: 132,334,796 S269P probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scin A G 12: 40,105,072 I174T possibly damaging Het
Serpinb8 A G 1: 107,597,470 M1V probably null Het
Smok3c A T 5: 138,064,709 I153F probably damaging Het
Spen G A 4: 141,476,108 S1736L possibly damaging Het
Sspo T A 6: 48,449,512 M155K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sun2 T C 15: 79,727,899 I528M probably benign Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Taok2 G T 7: 126,867,154 A831E possibly damaging Het
Tas2r126 T C 6: 42,434,805 F91L probably damaging Het
Tas2r140 A G 6: 133,054,959 S279P possibly damaging Het
Tiam1 A T 16: 89,860,260 L696H probably damaging Het
Trank1 T G 9: 111,365,796 S963A possibly damaging Het
Trf A G 9: 103,225,127 V184A probably benign Het
Ttll13 T A 7: 80,253,658 M231K possibly damaging Het
Tuba1a T G 15: 98,951,574 T41P probably benign Het
Zfhx4 A G 3: 5,413,044 Q3573R probably damaging Het
Zfp141 G A 7: 42,475,429 H540Y probably damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTGGATTCATTCTCATAGACTTC -3'
(R):5'- GTGCTATATTTTGCTAAGCTCCTGAAG -3'

Sequencing Primer
(F):5'- TTCAGCGTTAGTAGGTGC -3'
(R):5'- GCCTCTTTGTAACCTGAAATAACC -3'
Posted On2019-05-15