Incidental Mutation 'R7129:Abcg4'
ID552527
Institutional Source Beutler Lab
Gene Symbol Abcg4
Ensembl Gene ENSMUSG00000032131
Gene NameATP binding cassette subfamily G member 4
Synonyms6430517O04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R7129 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44273188-44288615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44279384 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 282 (K282E)
Ref Sequence ENSEMBL: ENSMUSP00000034648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034648] [ENSMUST00000160384] [ENSMUST00000161354] [ENSMUST00000161408] [ENSMUST00000162783]
Predicted Effect probably benign
Transcript: ENSMUST00000034648
AA Change: K282E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034648
Gene: ENSMUSG00000032131
AA Change: K282E

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 1.6e-49 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160384
Predicted Effect probably benign
Transcript: ENSMUST00000161354
AA Change: K282E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124647
Gene: ENSMUSG00000032131
AA Change: K282E

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 4.8e-47 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161408
Predicted Effect probably benign
Transcript: ENSMUST00000162783
AA Change: K34E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123999
Gene: ENSMUSG00000032131
AA Change: K34E

DomainStartEndE-ValueType
Blast:AAA 1 37 9e-20 BLAST
SCOP:d1gcya2 33 64 1e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein is a member of the White subfamily and plays an important role in cellular cholesterol homeostasis. This protein functions as either a homodimer or as a heterodimer with another ABC subfamily protein such as ABCG1. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a report allele exhibit increased brain lathosterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Abcg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Abcg4 APN 9 44275142 splice site probably benign
IGL00585:Abcg4 APN 9 44281623 missense probably benign 0.04
IGL02016:Abcg4 APN 9 44287350 missense probably damaging 0.99
IGL02085:Abcg4 APN 9 44281557 critical splice donor site probably null
IGL02142:Abcg4 APN 9 44277717 missense probably benign 0.18
IGL02171:Abcg4 APN 9 44275009 unclassified probably benign
IGL02309:Abcg4 APN 9 44281828 missense probably benign 0.21
IGL02882:Abcg4 APN 9 44277489 nonsense probably null
R0009:Abcg4 UTSW 9 44277649 splice site probably benign
R0023:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R0481:Abcg4 UTSW 9 44279369 missense probably benign 0.07
R0513:Abcg4 UTSW 9 44281687 missense possibly damaging 0.61
R0644:Abcg4 UTSW 9 44274699 missense possibly damaging 0.87
R0649:Abcg4 UTSW 9 44278033 missense probably benign 0.00
R1084:Abcg4 UTSW 9 44277469 missense probably benign 0.27
R1518:Abcg4 UTSW 9 44275369 missense probably benign 0.05
R1528:Abcg4 UTSW 9 44274723 missense probably damaging 0.99
R1702:Abcg4 UTSW 9 44275073 missense probably damaging 0.99
R1932:Abcg4 UTSW 9 44279394 missense probably benign 0.16
R4477:Abcg4 UTSW 9 44275086 missense probably damaging 1.00
R4661:Abcg4 UTSW 9 44287330 missense probably damaging 1.00
R4883:Abcg4 UTSW 9 44279319 missense probably damaging 1.00
R4901:Abcg4 UTSW 9 44277657 critical splice donor site probably null
R5039:Abcg4 UTSW 9 44281566 missense probably damaging 1.00
R5209:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R5329:Abcg4 UTSW 9 44279545 missense probably benign 0.00
R5492:Abcg4 UTSW 9 44278058 missense probably benign 0.01
R5521:Abcg4 UTSW 9 44279683 unclassified probably benign
R5558:Abcg4 UTSW 9 44281408 missense probably damaging 0.99
R5625:Abcg4 UTSW 9 44278036 missense probably benign 0.42
R6318:Abcg4 UTSW 9 44275348 missense probably benign
R7060:Abcg4 UTSW 9 44275128 missense probably benign 0.13
X0028:Abcg4 UTSW 9 44274634 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGCTCTCTGTCCCCAAGAG -3'
(R):5'- TGGTGTCCCTCATGAAGTCC -3'

Sequencing Primer
(F):5'- TCTGTCCCCAAGAGGCCTC -3'
(R):5'- CCAGTGCCAAGCTCTTTGAGATG -3'
Posted On2019-05-15