Incidental Mutation 'R7129:Dhx33'
ID552536
Institutional Source Beutler Lab
Gene Symbol Dhx33
Ensembl Gene ENSMUSG00000040620
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 33
Synonyms9430096J02Rik, 3110057P17Rik, Ddx33
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70984091-71004437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70993863 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 425 (I425N)
Ref Sequence ENSEMBL: ENSMUSP00000104167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108527] [ENSMUST00000124464] [ENSMUST00000155044]
Predicted Effect probably benign
Transcript: ENSMUST00000049048
SMART Domains Protein: ENSMUSP00000038018
Gene: ENSMUSG00000040620

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
Blast:DEXDc 41 76 3e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108527
AA Change: I425N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104167
Gene: ENSMUSG00000040620
AA Change: I425N

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
DEXDc 53 252 1.96e-29 SMART
HELICc 300 401 3.45e-16 SMART
HA2 461 554 3.29e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124464
AA Change: I201N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136051
Gene: ENSMUSG00000040620
AA Change: I201N

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HA2 237 330 3.29e-29 SMART
Pfam:OB_NTP_bind 364 464 7.7e-27 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000155044
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The DEAD box proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Nufip1 A G 14: 76,134,885 K480E possibly damaging Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Dhx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dhx33 APN 11 71001620 missense probably benign
IGL01357:Dhx33 APN 11 70993861 nonsense probably null
IGL01358:Dhx33 APN 11 70993861 nonsense probably null
IGL01359:Dhx33 APN 11 70993861 nonsense probably null
IGL01360:Dhx33 APN 11 70993861 nonsense probably null
IGL01558:Dhx33 APN 11 70999753 missense probably benign 0.01
IGL02232:Dhx33 APN 11 70987204 missense probably damaging 1.00
IGL02543:Dhx33 APN 11 70987240 missense probably damaging 1.00
R0013:Dhx33 UTSW 11 70993635 missense probably damaging 0.99
R0013:Dhx33 UTSW 11 70993635 missense probably damaging 0.99
R1544:Dhx33 UTSW 11 70999528 missense probably damaging 1.00
R1782:Dhx33 UTSW 11 71001640 missense probably damaging 1.00
R1909:Dhx33 UTSW 11 70989107 missense probably benign 0.02
R2074:Dhx33 UTSW 11 70999843 missense probably damaging 1.00
R3729:Dhx33 UTSW 11 70989152 missense probably benign 0.00
R3731:Dhx33 UTSW 11 70989152 missense probably benign 0.00
R5902:Dhx33 UTSW 11 70989131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTTCATTGCTAGGAGCTG -3'
(R):5'- GATAAAGCCAGGCACTCATGG -3'

Sequencing Primer
(F):5'- GTATTACACTGGCCAGGTTACAC -3'
(R):5'- GGCACTCATGGCCCTTTC -3'
Posted On2019-05-15