Incidental Mutation 'R7129:Nufip1'
ID552541
Institutional Source Beutler Lab
Gene Symbol Nufip1
Ensembl Gene ENSMUSG00000022009
Gene Namenuclear fragile X mental retardation protein interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7129 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location76110891-76137379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76134885 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 480 (K480E)
Ref Sequence ENSEMBL: ENSMUSP00000022586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022586
AA Change: K480E

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022586
Gene: ENSMUSG00000022009
AA Change: K480E

DomainStartEndE-ValueType
low complexity region 38 48 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
ZnF_C2H2 165 187 3.58e-2 SMART
ZnF_C2H2 188 212 5.4e1 SMART
low complexity region 291 304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA binding protein that contains a C2H2 zinc finger motif and a nuclear localization signal. This protein is associated with the nuclear matrix in perichromatin fibrils and, in neurons, localizes to the cytoplasm in association with endoplasmic reticulum ribosomes. This protein interacts with the fragile X mental retardation protein (FMRP), the tumor suppressor protein BRCA1, upregulates RNA polymerase II transcription, and is involved in box C/D snoRNP biogenesis. A pseudogene of this gene resides on chromosome 6q12. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,355 E443G probably damaging Het
2700049A03Rik A G 12: 71,216,230 probably null Het
3110082I17Rik A G 5: 139,363,983 Y104H probably damaging Het
Abcg4 T C 9: 44,279,384 K282E probably benign Het
Adamts17 T C 7: 67,121,010 S956P probably damaging Het
Adh1 T C 3: 138,280,474 V74A probably damaging Het
Akt1 A T 12: 112,659,649 M63K probably benign Het
Arfrp1 G A 2: 181,359,551 R177* probably null Het
Arl11 A G 14: 61,310,897 E52G possibly damaging Het
BC051019 T C 7: 109,720,618 S10G Het
Bfsp2 T A 9: 103,479,919 E103V probably damaging Het
Bms1 G T 6: 118,403,161 C728* probably null Het
Cachd1 T G 4: 100,918,066 N159K probably null Het
Cd38 A G 5: 43,910,309 N294S probably benign Het
Cfap54 T C 10: 93,016,571 N891S probably benign Het
Chsy3 A T 18: 59,410,298 H836L probably damaging Het
Cldn16 A T 16: 26,482,638 D232V probably damaging Het
Dhx33 A T 11: 70,993,863 I425N probably damaging Het
Dock4 A G 12: 40,828,879 N1506D probably damaging Het
Dok7 T C 5: 35,079,048 S227P probably damaging Het
Elf2 T C 3: 51,261,011 R201G probably damaging Het
Etaa1 T C 11: 17,940,339 R841G possibly damaging Het
Exoc4 T C 6: 33,971,999 Y926H probably damaging Het
Fras1 A G 5: 96,781,284 H3849R probably benign Het
Hapln3 C T 7: 79,121,824 G106R probably damaging Het
Hmcn1 A C 1: 150,577,210 probably null Het
Ifitm7 A T 16: 13,983,736 I53N possibly damaging Het
Ikbkap T C 4: 56,787,944 H329R probably damaging Het
Il6ra T C 3: 89,871,247 N433D probably damaging Het
Iqch C T 9: 63,421,909 V1048I probably benign Het
Kif20a A G 18: 34,632,535 T862A probably benign Het
Mcrs1 G A 15: 99,248,728 L141F probably damaging Het
Nkx3-2 A G 5: 41,761,674 S324P probably damaging Het
Nmi A T 2: 51,955,924 probably null Het
Oit3 T A 10: 59,428,344 I323F probably damaging Het
Olfr1450 A T 19: 12,954,114 H175L possibly damaging Het
Olfr699 T C 7: 106,790,483 K173E probably benign Het
Pcdha11 A G 18: 37,007,238 E640G probably benign Het
Phip C T 9: 82,877,300 V1366I probably damaging Het
Plin5 T C 17: 56,115,174 M162V probably null Het
Podxl2 A G 6: 88,843,505 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab4a A T 8: 123,827,330 D40V probably benign Het
Scn7a A G 2: 66,700,193 F603L probably benign Het
Slfn5 A T 11: 82,961,150 K701* probably null Het
Speer4f2 A G 5: 17,377,448 D223G Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tas2r117 A T 6: 132,803,387 T163S probably benign Het
Tecta T C 9: 42,347,991 D1532G probably damaging Het
Tmem63a T C 1: 180,954,876 I146T probably damaging Het
Ttn C A 2: 76,816,171 G12844W probably damaging Het
Usp22 T C 11: 61,162,949 I190V probably damaging Het
Usp24 T C 4: 106,362,215 I536T probably damaging Het
Vmn1r23 A G 6: 57,926,076 V239A possibly damaging Het
Vmn1r9 A C 6: 57,071,626 T229P probably damaging Het
Zbtb21 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC 16: 97,951,687 probably benign Het
Zbtb8a G C 4: 129,360,395 A102G probably damaging Het
Zfp51 T C 17: 21,461,709 W57R probably damaging Het
Other mutations in Nufip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Nufip1 APN 14 76115818 missense probably damaging 1.00
R0748:Nufip1 UTSW 14 76111068 missense probably damaging 1.00
R1576:Nufip1 UTSW 14 76134870 missense probably benign 0.00
R1641:Nufip1 UTSW 14 76126252 missense possibly damaging 0.55
R1992:Nufip1 UTSW 14 76134847 missense probably damaging 1.00
R5093:Nufip1 UTSW 14 76110973 missense probably benign 0.12
R5191:Nufip1 UTSW 14 76111989 missense probably damaging 1.00
R5212:Nufip1 UTSW 14 76133098 missense possibly damaging 0.72
R5282:Nufip1 UTSW 14 76114275 critical splice donor site probably null
R5635:Nufip1 UTSW 14 76126146 missense probably damaging 1.00
R5916:Nufip1 UTSW 14 76134900 makesense probably null
R5990:Nufip1 UTSW 14 76114188 missense probably damaging 0.99
R6328:Nufip1 UTSW 14 76111054 missense possibly damaging 0.62
R6333:Nufip1 UTSW 14 76111985 missense probably damaging 1.00
R6697:Nufip1 UTSW 14 76133073 missense probably benign 0.09
X0067:Nufip1 UTSW 14 76130861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGTATCTCAGCTGTAAGTC -3'
(R):5'- TGCATAAAGCCTGAGGACAG -3'

Sequencing Primer
(F):5'- GATAAACCTGTCTTACTAGCCTGTG -3'
(R):5'- GCCTGAGGACAGACTTAAAATCC -3'
Posted On2019-05-15