Incidental Mutation 'R7130:Vmn2r79'
ID552577
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7130 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87002266 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 291 (V291A)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
Predicted Effect probably damaging
Transcript: ENSMUST00000164462
AA Change: V291A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: V291A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,902 T735I possibly damaging Het
Adcy10 T A 1: 165,504,047 V83E probably damaging Het
Adcy6 A G 15: 98,597,229 Y701H probably benign Het
Apbb1 G A 7: 105,565,331 H518Y probably damaging Het
Arhgap20 T A 9: 51,849,747 V966E probably damaging Het
Bpifb9b T A 2: 154,311,672 N219K probably damaging Het
Btbd11 A C 10: 85,387,555 D76A unknown Het
Cdk19 A G 10: 40,479,765 T490A unknown Het
Dnah14 C T 1: 181,745,958 Q2945* probably null Het
Eif5b A G 1: 38,041,776 T733A probably damaging Het
Esyt3 T A 9: 99,318,170 D657V probably benign Het
Fat4 T A 3: 38,980,787 F2863I probably damaging Het
Fbxw14 T A 9: 109,271,282 I435L probably benign Het
Fus G A 7: 127,974,413 G253S unknown Het
Gdi2 T C 13: 3,548,891 V25A probably benign Het
Gm14025 A T 2: 129,039,181 V275D Het
Gm28729 T G 9: 96,519,404 R110S probably benign Het
Gm5286 T C 3: 94,198,527 W51R probably damaging Het
Gm9992 T C 17: 7,370,425 T304A probably benign Het
Gucd1 A G 10: 75,512,117 L28P possibly damaging Het
Hmgxb3 C T 18: 61,132,378 S1176N probably benign Het
Islr2 T C 9: 58,198,292 T606A probably damaging Het
Kcnf1 T C 12: 17,175,809 D137G probably benign Het
Klkb1 T A 8: 45,275,538 T395S probably benign Het
Morc2b T A 17: 33,136,288 S837C possibly damaging Het
Mrpl9 A G 3: 94,447,290 R204G probably benign Het
Naaladl1 A G 19: 6,105,988 E64G probably benign Het
Nlrx1 T C 9: 44,262,341 E521G possibly damaging Het
Npc2 A G 12: 84,765,307 S54P probably damaging Het
Nxpe2 T C 9: 48,339,537 M37V probably benign Het
Olfr1272 T C 2: 90,281,922 I218V probably benign Het
Olfr1412 C T 1: 92,588,912 A194V probably benign Het
Olfr263 T G 13: 21,133,246 V157G probably benign Het
Olfr699 A G 7: 106,790,182 L273P probably benign Het
Osbpl9 G A 4: 109,083,099 R213C probably benign Het
Pard3 C A 8: 127,415,683 R907S probably damaging Het
Pcdhb11 A G 18: 37,423,506 S630G probably benign Het
Pcdhb17 G A 18: 37,485,445 C96Y probably damaging Het
Pclo C T 5: 14,679,342 T2738I unknown Het
Pcnx2 G A 8: 125,753,584 R1995* probably null Het
Ppm1a T A 12: 72,784,233 N177K probably benign Het
Rfx6 A T 10: 51,678,380 K106* probably null Het
Rhoh T C 5: 65,892,864 V159A probably damaging Het
Rreb1 T C 13: 37,899,748 V129A probably damaging Het
Sdccag8 C A 1: 176,874,601 A424D probably damaging Het
Sdf2 T C 11: 78,245,997 M1T probably null Het
Sftpb T A 6: 72,305,824 F94I possibly damaging Het
Slc38a2 G T 15: 96,691,382 H410Q probably damaging Het
Slc40a1 A T 1: 45,921,224 V68E probably damaging Het
Srd5a3 T C 5: 76,149,837 V162A possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tango6 A G 8: 106,807,101 D953G probably damaging Het
Tdrd7 T C 4: 46,029,693 S1009P probably damaging Het
Thap3 T C 4: 151,988,916 Y14C possibly damaging Het
Tmem143 T A 7: 45,909,477 M281K possibly damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Tsga10 A G 1: 37,783,884 I516T probably damaging Het
Ttn T C 2: 76,890,669 I6804V unknown Het
Ubtfl1 C A 9: 18,409,847 P224T probably damaging Het
Umad1 G T 6: 8,427,185 C120F probably null Het
Usp45 A T 4: 21,782,923 H105L probably damaging Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
PIT4445001:Vmn2r79 UTSW 7 87002200 missense possibly damaging 0.46
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGAATTGAGAGCAGGAATGG -3'
(R):5'- TAAGTCCACCACAGTTTAGCC -3'

Sequencing Primer
(F):5'- GGAAAGTAACACTGTCTGCTTAGC -3'
(R):5'- CCACAGTTTAGCCAATGAAATGTC -3'
Posted On2019-05-15