Incidental Mutation 'R7130:Pard3'
ID552584
Institutional Source Beutler Lab
Gene Symbol Pard3
Ensembl Gene ENSMUSG00000025812
Gene Namepar-3 family cell polarity regulator
SynonymsASIP, PAR-3, Pard3a, Par3, D8Ertd580e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7130 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location127063893-127612286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127415683 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 907 (R907S)
Ref Sequence ENSEMBL: ENSMUSP00000125453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026921] [ENSMUST00000079777] [ENSMUST00000159537] [ENSMUST00000160272] [ENSMUST00000160581] [ENSMUST00000160766] [ENSMUST00000161355] [ENSMUST00000162309] [ENSMUST00000162456] [ENSMUST00000162531] [ENSMUST00000162536] [ENSMUST00000162602]
Predicted Effect probably damaging
Transcript: ENSMUST00000026921
AA Change: R892S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026921
Gene: ENSMUSG00000025812
AA Change: R892S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.1e-72 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 3e-10 PDB
low complexity region 863 875 N/A INTRINSIC
low complexity region 892 902 N/A INTRINSIC
low complexity region 921 950 N/A INTRINSIC
low complexity region 965 1005 N/A INTRINSIC
low complexity region 1162 1200 N/A INTRINSIC
low complexity region 1264 1281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079777
AA Change: R772S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078710
Gene: ENSMUSG00000025812
AA Change: R772S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159537
AA Change: R852S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124934
Gene: ENSMUSG00000025812
AA Change: R852S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.7e-73 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 717 727 N/A INTRINSIC
PDB:4DC2|Z 756 783 2e-10 PDB
low complexity region 823 835 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
low complexity region 881 910 N/A INTRINSIC
low complexity region 925 943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160272
AA Change: R907S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125453
Gene: ENSMUSG00000025812
AA Change: R907S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.7e-60 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 878 890 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 936 965 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1177 1215 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160581
AA Change: R870S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124141
Gene: ENSMUSG00000025812
AA Change: R870S

DomainStartEndE-ValueType
Pfam:DUF3534 4 149 7.1e-73 PFAM
low complexity region 237 249 N/A INTRINSIC
PDZ 285 364 2.34e-6 SMART
low complexity region 434 443 N/A INTRINSIC
PDZ 472 551 4.1e-20 SMART
PDZ 589 674 9.87e-14 SMART
low complexity region 764 774 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
low complexity region 870 880 N/A INTRINSIC
low complexity region 899 928 N/A INTRINSIC
low complexity region 943 983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160766
AA Change: R820S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124533
Gene: ENSMUSG00000025812
AA Change: R820S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
low complexity region 820 830 N/A INTRINSIC
low complexity region 849 878 N/A INTRINSIC
low complexity region 893 933 N/A INTRINSIC
low complexity region 1090 1128 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124789
Gene: ENSMUSG00000025812
AA Change: R827S

DomainStartEndE-ValueType
Pfam:DUF3534 3 122 9.6e-37 PFAM
PDZ 214 293 2.34e-6 SMART
low complexity region 363 372 N/A INTRINSIC
PDZ 401 480 4.1e-20 SMART
PDZ 518 603 9.87e-14 SMART
low complexity region 693 703 N/A INTRINSIC
PDB:4DC2|Z 732 759 2e-10 PDB
low complexity region 799 811 N/A INTRINSIC
low complexity region 828 838 N/A INTRINSIC
low complexity region 857 886 N/A INTRINSIC
low complexity region 901 919 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123951
Gene: ENSMUSG00000025812
AA Change: R144S

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
PDB:4DC2|Z 48 75 4e-11 PDB
low complexity region 116 128 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
low complexity region 174 203 N/A INTRINSIC
low complexity region 218 258 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161355
AA Change: R876S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125064
Gene: ENSMUSG00000025812
AA Change: R876S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 886 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 949 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162309
AA Change: R906S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124282
Gene: ENSMUSG00000025812
AA Change: R906S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 877 889 N/A INTRINSIC
low complexity region 906 916 N/A INTRINSIC
low complexity region 935 964 N/A INTRINSIC
low complexity region 979 1019 N/A INTRINSIC
low complexity region 1176 1214 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162456
AA Change: R772S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124162
Gene: ENSMUSG00000025812
AA Change: R772S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162531
AA Change: R867S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125610
Gene: ENSMUSG00000025812
AA Change: R867S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 8.4e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 586 671 9.87e-14 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 838 850 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 896 925 N/A INTRINSIC
low complexity region 940 980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162536
AA Change: R862S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125212
Gene: ENSMUSG00000025812
AA Change: R862S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 555 640 9.87e-14 SMART
low complexity region 727 737 N/A INTRINSIC
PDB:4DC2|Z 766 793 3e-10 PDB
low complexity region 833 845 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
low complexity region 891 920 N/A INTRINSIC
low complexity region 935 975 N/A INTRINSIC
low complexity region 1132 1170 N/A INTRINSIC
low complexity region 1234 1251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162602
AA Change: R910S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125450
Gene: ENSMUSG00000025812
AA Change: R910S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 774 784 N/A INTRINSIC
PDB:4DC2|Z 813 840 2e-10 PDB
low complexity region 881 893 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 939 968 N/A INTRINSIC
low complexity region 983 1023 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124718
Gene: ENSMUSG00000025812
AA Change: R896S

DomainStartEndE-ValueType
Pfam:DUF3534 21 166 1.4e-60 PFAM
low complexity region 254 266 N/A INTRINSIC
PDZ 302 381 2.34e-6 SMART
low complexity region 451 460 N/A INTRINSIC
PDZ 489 568 4.1e-20 SMART
PDZ 619 704 9.87e-14 SMART
low complexity region 791 801 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 926 955 N/A INTRINSIC
low complexity region 970 1010 N/A INTRINSIC
low complexity region 1167 1205 N/A INTRINSIC
low complexity region 1269 1286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E12.5 associated with growth retardation, abnormal heart development, and abnormal epicardial cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,902 T735I possibly damaging Het
Adcy10 T A 1: 165,504,047 V83E probably damaging Het
Adcy6 A G 15: 98,597,229 Y701H probably benign Het
Apbb1 G A 7: 105,565,331 H518Y probably damaging Het
Arhgap20 T A 9: 51,849,747 V966E probably damaging Het
Bbx T A 16: 50,210,442 probably null Het
Bpifb9b T A 2: 154,311,672 N219K probably damaging Het
Btbd11 A C 10: 85,387,555 D76A unknown Het
Cdk19 A G 10: 40,479,765 T490A unknown Het
Cyb5r1 T G 1: 134,408,021 probably benign Het
Dnah14 C T 1: 181,745,958 Q2945* probably null Het
Eif5b A G 1: 38,041,776 T733A probably damaging Het
Esyt3 T A 9: 99,318,170 D657V probably benign Het
Fat4 T A 3: 38,980,787 F2863I probably damaging Het
Fbxw14 T A 9: 109,271,282 I435L probably benign Het
Fus G A 7: 127,974,413 G253S unknown Het
Gdi2 T C 13: 3,548,891 V25A probably benign Het
Gm14025 A T 2: 129,039,181 V275D Het
Gm28729 T G 9: 96,519,404 R110S probably benign Het
Gm5286 T C 3: 94,198,527 W51R probably damaging Het
Gm9992 T C 17: 7,370,425 T304A probably benign Het
Gucd1 A G 10: 75,512,117 L28P possibly damaging Het
Hmgxb3 C T 18: 61,132,378 S1176N probably benign Het
Islr2 T C 9: 58,198,292 T606A probably damaging Het
Kcnf1 T C 12: 17,175,809 D137G probably benign Het
Klkb1 T A 8: 45,275,538 T395S probably benign Het
Morc2b T A 17: 33,136,288 S837C possibly damaging Het
Mrpl9 A G 3: 94,447,290 R204G probably benign Het
Naaladl1 A G 19: 6,105,988 E64G probably benign Het
Nlrx1 T C 9: 44,262,341 E521G possibly damaging Het
Npc2 A G 12: 84,765,307 S54P probably damaging Het
Nxpe2 T C 9: 48,339,537 M37V probably benign Het
Olfr1272 T C 2: 90,281,922 I218V probably benign Het
Olfr1412 C T 1: 92,588,912 A194V probably benign Het
Olfr263 T G 13: 21,133,246 V157G probably benign Het
Olfr699 A G 7: 106,790,182 L273P probably benign Het
Osbpl9 G A 4: 109,083,099 R213C probably benign Het
Pcdhb11 A G 18: 37,423,506 S630G probably benign Het
Pcdhb17 G A 18: 37,485,445 C96Y probably damaging Het
Pclo C T 5: 14,679,342 T2738I unknown Het
Pcnx2 G A 8: 125,753,584 R1995* probably null Het
Ppm1a T A 12: 72,784,233 N177K probably benign Het
Rfx6 A T 10: 51,678,380 K106* probably null Het
Rhoh T C 5: 65,892,864 V159A probably damaging Het
Rreb1 T C 13: 37,899,748 V129A probably damaging Het
Sdccag8 C A 1: 176,874,601 A424D probably damaging Het
Sdf2 T C 11: 78,245,997 M1T probably null Het
Sftpb T A 6: 72,305,824 F94I possibly damaging Het
Slc38a2 G T 15: 96,691,382 H410Q probably damaging Het
Slc40a1 A T 1: 45,921,224 V68E probably damaging Het
Srd5a3 T C 5: 76,149,837 V162A possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tango6 A G 8: 106,807,101 D953G probably damaging Het
Tdrd7 T C 4: 46,029,693 S1009P probably damaging Het
Thap3 T C 4: 151,988,916 Y14C possibly damaging Het
Tmem143 T A 7: 45,909,477 M281K possibly damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Tsga10 A G 1: 37,783,884 I516T probably damaging Het
Ttn T C 2: 76,890,669 I6804V unknown Het
Ubtfl1 C A 9: 18,409,847 P224T probably damaging Het
Umad1 G T 6: 8,427,185 C120F probably null Het
Vmn2r79 T C 7: 87,002,266 V291A probably damaging Het
Other mutations in Pard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pard3 APN 8 127359818 splice site probably benign
IGL00484:Pard3 APN 8 127371846 missense probably benign 0.05
IGL00674:Pard3 APN 8 127388678 missense probably damaging 1.00
IGL01471:Pard3 APN 8 127378246 missense probably benign 0.01
IGL01505:Pard3 APN 8 127324063 missense probably damaging 1.00
IGL02252:Pard3 APN 8 127398756 missense probably benign 0.09
IGL02511:Pard3 APN 8 127161320 splice site probably benign
IGL02838:Pard3 APN 8 127426647 missense probably damaging 0.99
IGL02948:Pard3 APN 8 127306494 missense probably benign 0.00
IGL02987:Pard3 APN 8 127389491 missense probably damaging 0.98
IGL03037:Pard3 APN 8 127306494 missense probably benign 0.00
IGL03084:Pard3 APN 8 127593092 missense probably damaging 0.96
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0029:Pard3 UTSW 8 127426758 splice site probably benign
R0109:Pard3 UTSW 8 127398666 missense probably damaging 1.00
R0309:Pard3 UTSW 8 127376897 splice site probably benign
R0415:Pard3 UTSW 8 127610566 missense probably damaging 1.00
R0507:Pard3 UTSW 8 127371486 splice site probably benign
R1055:Pard3 UTSW 8 127378280 missense probably benign 0.34
R1305:Pard3 UTSW 8 127306410 missense possibly damaging 0.62
R1619:Pard3 UTSW 8 127380502 missense probably benign 0.02
R1855:Pard3 UTSW 8 127447812 splice site probably null
R2001:Pard3 UTSW 8 127064347 utr 5 prime probably null
R2060:Pard3 UTSW 8 127398604 missense probably benign 0.05
R2064:Pard3 UTSW 8 127610611 missense probably damaging 1.00
R2113:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R2136:Pard3 UTSW 8 127376885 critical splice donor site probably null
R2224:Pard3 UTSW 8 127359776 missense probably damaging 1.00
R2252:Pard3 UTSW 8 127610599 missense probably damaging 1.00
R3870:Pard3 UTSW 8 127409686 missense probably damaging 1.00
R4154:Pard3 UTSW 8 127474396 missense probably damaging 1.00
R4212:Pard3 UTSW 8 127610458 missense probably benign 0.43
R4243:Pard3 UTSW 8 127371647 missense probably benign 0.09
R4523:Pard3 UTSW 8 127398627 missense probably benign 0.08
R4857:Pard3 UTSW 8 127324054 missense probably damaging 0.98
R4876:Pard3 UTSW 8 127561469 intron probably benign
R4877:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R5197:Pard3 UTSW 8 127073290 splice site probably null
R5215:Pard3 UTSW 8 127378264 missense probably damaging 1.00
R5279:Pard3 UTSW 8 127460386 critical splice donor site probably null
R5349:Pard3 UTSW 8 127415743 missense probably damaging 1.00
R5479:Pard3 UTSW 8 127370355 missense probably damaging 1.00
R5514:Pard3 UTSW 8 127426605 missense probably damaging 1.00
R5681:Pard3 UTSW 8 127389433 missense possibly damaging 0.81
R5934:Pard3 UTSW 8 127389338 missense probably damaging 1.00
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6187:Pard3 UTSW 8 127073273 missense probably benign 0.00
R6382:Pard3 UTSW 8 127376783 missense probably damaging 1.00
R6774:Pard3 UTSW 8 127410747 missense probably damaging 0.98
R7267:Pard3 UTSW 8 127371575 missense probably damaging 0.97
R7358:Pard3 UTSW 8 127593092 missense probably damaging 0.98
R7528:Pard3 UTSW 8 127603165 missense probably damaging 1.00
R7537:Pard3 UTSW 8 127610582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTGAACTTGTAGCTTCCATC -3'
(R):5'- ACGGTAGACCTCAGATGCAC -3'

Sequencing Primer
(F):5'- GAACTTGTAGCTTCCATCTCGTC -3'
(R):5'- TGGTCACATGTCTGAGAACC -3'
Posted On2019-05-15