Incidental Mutation 'R7130:Esyt3'
ID552591
Institutional Source Beutler Lab
Gene Symbol Esyt3
Ensembl Gene ENSMUSG00000037681
Gene Nameextended synaptotagmin-like protein 3
SynonymsFam62c, D9Ertd280e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R7130 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location99309963-99358557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99318170 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 657 (D657V)
Ref Sequence ENSEMBL: ENSMUSP00000038757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042158] [ENSMUST00000187520]
Predicted Effect probably benign
Transcript: ENSMUST00000042158
AA Change: D657V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038757
Gene: ENSMUSG00000037681
AA Change: D657V

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Pfam:SMP_LBD 118 295 3.7e-63 PFAM
C2 311 411 9.23e-20 SMART
low complexity region 422 432 N/A INTRINSIC
C2 449 563 6.6e-7 SMART
low complexity region 658 673 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
C2 775 880 4.91e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187520
SMART Domains Protein: ENSMUSP00000140567
Gene: ENSMUSG00000037681

DomainStartEndE-ValueType
C2 2 83 5.9e-12 SMART
low complexity region 94 104 N/A INTRINSIC
C2 121 198 2.2e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,902 T735I possibly damaging Het
Adcy10 T A 1: 165,504,047 V83E probably damaging Het
Adcy6 A G 15: 98,597,229 Y701H probably benign Het
Apbb1 G A 7: 105,565,331 H518Y probably damaging Het
Arhgap20 T A 9: 51,849,747 V966E probably damaging Het
Bpifb9b T A 2: 154,311,672 N219K probably damaging Het
Btbd11 A C 10: 85,387,555 D76A unknown Het
Cdk19 A G 10: 40,479,765 T490A unknown Het
Dnah14 C T 1: 181,745,958 Q2945* probably null Het
Eif5b A G 1: 38,041,776 T733A probably damaging Het
Fat4 T A 3: 38,980,787 F2863I probably damaging Het
Fbxw14 T A 9: 109,271,282 I435L probably benign Het
Fus G A 7: 127,974,413 G253S unknown Het
Gdi2 T C 13: 3,548,891 V25A probably benign Het
Gm14025 A T 2: 129,039,181 V275D Het
Gm28729 T G 9: 96,519,404 R110S probably benign Het
Gm5286 T C 3: 94,198,527 W51R probably damaging Het
Gm9992 T C 17: 7,370,425 T304A probably benign Het
Gucd1 A G 10: 75,512,117 L28P possibly damaging Het
Hmgxb3 C T 18: 61,132,378 S1176N probably benign Het
Islr2 T C 9: 58,198,292 T606A probably damaging Het
Kcnf1 T C 12: 17,175,809 D137G probably benign Het
Klkb1 T A 8: 45,275,538 T395S probably benign Het
Morc2b T A 17: 33,136,288 S837C possibly damaging Het
Mrpl9 A G 3: 94,447,290 R204G probably benign Het
Naaladl1 A G 19: 6,105,988 E64G probably benign Het
Nlrx1 T C 9: 44,262,341 E521G possibly damaging Het
Npc2 A G 12: 84,765,307 S54P probably damaging Het
Nxpe2 T C 9: 48,339,537 M37V probably benign Het
Olfr1272 T C 2: 90,281,922 I218V probably benign Het
Olfr1412 C T 1: 92,588,912 A194V probably benign Het
Olfr263 T G 13: 21,133,246 V157G probably benign Het
Olfr699 A G 7: 106,790,182 L273P probably benign Het
Osbpl9 G A 4: 109,083,099 R213C probably benign Het
Pard3 C A 8: 127,415,683 R907S probably damaging Het
Pcdhb11 A G 18: 37,423,506 S630G probably benign Het
Pcdhb17 G A 18: 37,485,445 C96Y probably damaging Het
Pclo C T 5: 14,679,342 T2738I unknown Het
Pcnx2 G A 8: 125,753,584 R1995* probably null Het
Ppm1a T A 12: 72,784,233 N177K probably benign Het
Rfx6 A T 10: 51,678,380 K106* probably null Het
Rhoh T C 5: 65,892,864 V159A probably damaging Het
Rreb1 T C 13: 37,899,748 V129A probably damaging Het
Sdccag8 C A 1: 176,874,601 A424D probably damaging Het
Sdf2 T C 11: 78,245,997 M1T probably null Het
Sftpb T A 6: 72,305,824 F94I possibly damaging Het
Slc38a2 G T 15: 96,691,382 H410Q probably damaging Het
Slc40a1 A T 1: 45,921,224 V68E probably damaging Het
Srd5a3 T C 5: 76,149,837 V162A possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tango6 A G 8: 106,807,101 D953G probably damaging Het
Tdrd7 T C 4: 46,029,693 S1009P probably damaging Het
Thap3 T C 4: 151,988,916 Y14C possibly damaging Het
Tmem143 T A 7: 45,909,477 M281K possibly damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Tsga10 A G 1: 37,783,884 I516T probably damaging Het
Ttn T C 2: 76,890,669 I6804V unknown Het
Ubtfl1 C A 9: 18,409,847 P224T probably damaging Het
Umad1 G T 6: 8,427,185 C120F probably null Het
Usp45 A T 4: 21,782,923 H105L probably damaging Het
Vmn2r79 T C 7: 87,002,266 V291A probably damaging Het
Other mutations in Esyt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Esyt3 APN 9 99315225 missense probably benign 0.07
IGL02596:Esyt3 APN 9 99328015 missense probably benign 0.02
IGL02716:Esyt3 APN 9 99317224 missense probably damaging 1.00
IGL02836:Esyt3 APN 9 99320907 splice site probably benign
IGL03372:Esyt3 APN 9 99336056 splice site probably benign
R0008:Esyt3 UTSW 9 99338807 missense possibly damaging 0.89
R1217:Esyt3 UTSW 9 99318044 missense possibly damaging 0.92
R1395:Esyt3 UTSW 9 99316782 unclassified probably benign
R1478:Esyt3 UTSW 9 99318066 missense probably benign 0.03
R1710:Esyt3 UTSW 9 99336191 missense probably benign
R1792:Esyt3 UTSW 9 99358116 nonsense probably null
R1913:Esyt3 UTSW 9 99320311 missense probably benign 0.00
R3792:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3793:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3937:Esyt3 UTSW 9 99336192 missense probably benign
R3964:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R3965:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R4061:Esyt3 UTSW 9 99320838 missense probably damaging 1.00
R4088:Esyt3 UTSW 9 99324237 missense probably benign
R4436:Esyt3 UTSW 9 99358025 intron probably benign
R5274:Esyt3 UTSW 9 99318297 missense probably benign
R5590:Esyt3 UTSW 9 99358413 utr 5 prime probably benign
R5705:Esyt3 UTSW 9 99318207 missense probably benign 0.00
R6543:Esyt3 UTSW 9 99338772 missense possibly damaging 0.77
R6738:Esyt3 UTSW 9 99320293 missense probably damaging 0.98
R7000:Esyt3 UTSW 9 99322153 missense probably damaging 0.99
R7019:Esyt3 UTSW 9 99315285 missense probably benign 0.11
R7104:Esyt3 UTSW 9 99338787 missense probably damaging 1.00
R7141:Esyt3 UTSW 9 99321440 missense probably benign 0.12
R7145:Esyt3 UTSW 9 99319574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGAGTGAGGACATGCTG -3'
(R):5'- GGACCCGACGCTCTAAAGAAAG -3'

Sequencing Primer
(F):5'- CGTGAGTGGCCATGCGAATG -3'
(R):5'- AGGTCCTCTGTTCATCAAGAAGG -3'
Posted On2019-05-15