Incidental Mutation 'R7131:Cep250'
ID552624
Institutional Source Beutler Lab
Gene Symbol Cep250
Ensembl Gene ENSMUSG00000038241
Gene Namecentrosomal protein 250
SynonymsCep2, Inmp, B230210E21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R7131 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location155956458-155998900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155965077 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 193 (M193T)
Ref Sequence ENSEMBL: ENSMUSP00000114426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109618] [ENSMUST00000109619] [ENSMUST00000151569]
Predicted Effect probably damaging
Transcript: ENSMUST00000039994
AA Change: M193T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: M193T

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 4.2e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.47e-18 PROSPERO
internal_repeat_1 465 481 1.47e-18 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 990 1007 N/A INTRINSIC
low complexity region 1043 1053 N/A INTRINSIC
low complexity region 1138 1143 N/A INTRINSIC
low complexity region 1182 1195 N/A INTRINSIC
coiled coil region 1257 1687 N/A INTRINSIC
low complexity region 1872 1895 N/A INTRINSIC
low complexity region 1919 1933 N/A INTRINSIC
low complexity region 1941 1960 N/A INTRINSIC
internal_repeat_2 2002 2052 3.9e-6 PROSPERO
coiled coil region 2068 2169 N/A INTRINSIC
coiled coil region 2196 2217 N/A INTRINSIC
coiled coil region 2251 2310 N/A INTRINSIC
low complexity region 2325 2338 N/A INTRINSIC
coiled coil region 2340 2366 N/A INTRINSIC
low complexity region 2379 2388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094421
AA Change: M193T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: M193T

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 5.4e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
coiled coil region 400 1165 N/A INTRINSIC
coiled coil region 1237 1667 N/A INTRINSIC
low complexity region 1852 1875 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1921 1940 N/A INTRINSIC
internal_repeat_1 1982 2032 3.35e-6 PROSPERO
coiled coil region 2048 2149 N/A INTRINSIC
coiled coil region 2176 2197 N/A INTRINSIC
coiled coil region 2231 2290 N/A INTRINSIC
low complexity region 2305 2318 N/A INTRINSIC
coiled coil region 2320 2346 N/A INTRINSIC
low complexity region 2359 2368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109618
AA Change: M193T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105247
Gene: ENSMUSG00000038241
AA Change: M193T

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 2.3e-57 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 317 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109619
AA Change: M193T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: M193T

DomainStartEndE-ValueType
Pfam:Rootletin 38 214 4.1e-60 PFAM
low complexity region 215 225 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
internal_repeat_1 445 461 1.51e-18 PROSPERO
internal_repeat_1 466 482 1.51e-18 PROSPERO
low complexity region 496 507 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
low complexity region 670 678 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 897 915 N/A INTRINSIC
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1139 1144 N/A INTRINSIC
low complexity region 1183 1196 N/A INTRINSIC
coiled coil region 1258 1688 N/A INTRINSIC
low complexity region 1873 1896 N/A INTRINSIC
low complexity region 1920 1934 N/A INTRINSIC
low complexity region 1942 1961 N/A INTRINSIC
internal_repeat_2 2003 2053 3.95e-6 PROSPERO
coiled coil region 2069 2170 N/A INTRINSIC
coiled coil region 2197 2218 N/A INTRINSIC
coiled coil region 2252 2311 N/A INTRINSIC
low complexity region 2326 2339 N/A INTRINSIC
coiled coil region 2341 2367 N/A INTRINSIC
low complexity region 2380 2389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151569
AA Change: M193T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114426
Gene: ENSMUSG00000038241
AA Change: M193T

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 1.3e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.16e-14 PROSPERO
internal_repeat_1 465 481 1.16e-14 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,548,956 V435A possibly damaging Het
Abca13 A G 11: 9,291,893 N1252S probably benign Het
Abcc3 A T 11: 94,365,031 F543I probably damaging Het
Adam15 T A 3: 89,346,980 Q170L possibly damaging Het
AF366264 A T 8: 13,836,982 W370R probably damaging Het
Aldoc A G 11: 78,324,456 I19V possibly damaging Het
Atrip T C 9: 109,060,420 I711M probably benign Het
Brwd1 A C 16: 96,066,498 L149R probably damaging Het
Capn9 A T 8: 124,576,278 D45V probably damaging Het
Card9 G A 2: 26,358,835 R101C probably damaging Het
Casc1 A T 6: 145,177,406 L578Q probably null Het
Ccdc36 A T 9: 108,417,420 D98E probably benign Het
Ccdc87 A G 19: 4,841,757 E759G probably damaging Het
Cfap54 T C 10: 92,821,104 K3029E probably benign Het
Chrna9 G A 5: 65,977,141 G445D possibly damaging Het
Cluap1 C T 16: 3,940,775 S367L probably benign Het
Col5a1 A G 2: 27,929,486 D200G unknown Het
Crhr2 T C 6: 55,092,127 N388D Het
Cyp2b23 A G 7: 26,681,413 L129P probably benign Het
Cyr61 T C 3: 145,648,781 D125G probably damaging Het
Dctd A G 8: 48,112,040 S67G probably benign Het
Dhtkd1 C G 2: 5,904,070 V738L probably benign Het
Dnah17 C T 11: 118,079,658 D2173N probably benign Het
Dnah7c G T 1: 46,681,772 A2819S probably benign Het
Dot1l A G 10: 80,792,341 H1071R unknown Het
Doxl2 T A 6: 48,976,372 Y410* probably null Het
Dync2h1 T A 9: 7,075,786 D3027V probably damaging Het
Efl1 A G 7: 82,658,064 Y56C probably damaging Het
Eif4e1b A T 13: 54,784,100 R29W probably null Het
Evc2 A G 5: 37,410,258 R860G probably damaging Het
Fbxl12 G A 9: 20,644,383 probably benign Het
Fibp T A 19: 5,461,491 I129N probably damaging Het
Folh1 G T 7: 86,726,112 H555Q probably damaging Het
Gcnt4 A T 13: 96,946,519 T108S probably damaging Het
Gm436 A G 4: 144,670,067 V365A probably damaging Het
H1fnt T A 15: 98,256,369 K300* probably null Het
Hecw2 A T 1: 53,865,121 V1156E probably damaging Het
Herc3 C G 6: 58,887,424 A681G probably damaging Het
Igkv13-84 T A 6: 68,939,780 C20* probably null Het
Ivd C A 2: 118,869,774 T94K probably damaging Het
Kank2 C T 9: 21,794,679 A348T probably benign Het
Kcnma1 T C 14: 23,367,494 Y889C probably damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,849,616 probably benign Het
Kmt5b T A 19: 3,815,412 D825E probably benign Het
Krt39 C T 11: 99,520,871 A130T probably benign Het
Krtap4-9 C T 11: 99,785,457 T68I unknown Het
Lmbr1l A T 15: 98,906,323 V365E probably benign Het
Lonp1 C T 17: 56,617,814 R531Q probably damaging Het
Mecom T A 3: 29,980,945 H194L probably damaging Het
Mlx C T 11: 101,089,242 H188Y probably damaging Het
Mrps10 T C 17: 47,375,015 S77P probably damaging Het
Mst1 A G 9: 108,084,931 E716G probably null Het
Mttp C T 3: 138,116,132 V210I probably benign Het
Mug2 T C 6: 122,075,247 V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 M1T probably null Het
Neurog1 A T 13: 56,251,750 N61K probably benign Het
Nlrp14 A G 7: 107,184,814 D581G possibly damaging Het
Nlrp4a C A 7: 26,449,833 N288K probably benign Het
Notch3 T A 17: 32,144,217 H1264L probably benign Het
Olfr384 A T 11: 73,602,736 D52V possibly damaging Het
Olfr394 A T 11: 73,887,954 C139* probably null Het
Olfr402 A G 11: 74,155,780 M209V probably benign Het
Patl2 A T 2: 122,121,782 probably null Het
Pfkfb4 A G 9: 109,007,302 T133A probably benign Het
Pla2g4f T C 2: 120,304,554 E471G probably null Het
Postn T C 3: 54,362,635 V45A probably damaging Het
Ppan T A 9: 20,891,154 V257E possibly damaging Het
Ptcra C G 17: 46,763,596 A7P probably damaging Het
Ptprd C T 4: 76,066,340 R523H probably damaging Het
Pycrl A T 15: 75,918,695 I105N possibly damaging Het
Rfx1 C A 8: 84,095,079 Q815K probably damaging Het
Rfx3 T A 19: 27,768,628 K668* probably null Het
Ryr2 A T 13: 11,640,327 D3661E possibly damaging Het
Ryr2 A G 13: 11,668,811 probably null Het
Sec23ip T A 7: 128,779,640 S974T probably damaging Het
Setbp1 A G 18: 79,086,960 F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,796,418 probably benign Het
Sh3pxd2b A G 11: 32,422,072 K413R probably damaging Het
Slc39a12 T C 2: 14,449,803 V544A probably damaging Het
Slc6a7 T C 18: 61,002,202 Y418C probably damaging Het
Snx19 T G 9: 30,427,893 I109S probably damaging Het
Spg20 T C 3: 55,121,799 probably null Het
Sptbn2 A T 19: 4,749,460 Q2097L probably null Het
Syne1 T C 10: 5,228,221 K4751R probably damaging Het
Tigit C A 16: 43,662,252 G40C probably damaging Het
Tmem181a T A 17: 6,297,972 I264K probably damaging Het
Tom1 T A 8: 75,057,249 I287N possibly damaging Het
Top2a G A 11: 99,004,182 P864L possibly damaging Het
Trmt44 A T 5: 35,571,066 V290E probably damaging Het
Try4 T C 6: 41,304,403 I93T probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Uspl1 A T 5: 149,193,935 R109S probably benign Het
Vav3 T A 3: 109,664,346 F755I probably damaging Het
Vezt A T 10: 93,970,547 Y667* probably null Het
Vmn1r231 T A 17: 20,889,878 L258F possibly damaging Het
Zfp207 T C 11: 80,395,528 M489T unknown Het
Zfp462 A G 4: 55,009,380 T449A probably benign Het
Zfp956 C A 6: 47,955,847 Q19K probably benign Het
Zkscan8 A T 13: 21,525,273 W152R probably damaging Het
Other mutations in Cep250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Cep250 APN 2 155991329 missense probably benign 0.00
IGL01077:Cep250 APN 2 155962134 missense probably damaging 1.00
IGL01084:Cep250 APN 2 155998393 missense probably benign 0.00
IGL01400:Cep250 APN 2 155998291 missense possibly damaging 0.78
IGL01570:Cep250 APN 2 155967663 splice site probably benign
IGL01583:Cep250 APN 2 155976149 missense probably damaging 0.99
IGL01590:Cep250 APN 2 155992317 missense possibly damaging 0.80
IGL01647:Cep250 APN 2 155983376 missense probably benign 0.02
IGL01959:Cep250 APN 2 155983359 missense possibly damaging 0.63
IGL02066:Cep250 APN 2 155976521 missense probably damaging 1.00
IGL02219:Cep250 APN 2 155991594 missense probably benign 0.26
IGL02322:Cep250 APN 2 155990328 missense probably damaging 1.00
IGL02728:Cep250 APN 2 155983278 unclassified probably benign
IGL02955:Cep250 APN 2 155975756 missense probably benign 0.01
IGL03369:Cep250 APN 2 155990271 missense probably benign 0.00
R0366:Cep250 UTSW 2 155988401 missense probably benign 0.00
R0403:Cep250 UTSW 2 155992349 missense probably damaging 0.99
R0441:Cep250 UTSW 2 155972004 missense possibly damaging 0.82
R0482:Cep250 UTSW 2 155964974 splice site probably benign
R0507:Cep250 UTSW 2 155992532 missense possibly damaging 0.60
R0614:Cep250 UTSW 2 155970097 nonsense probably null
R0855:Cep250 UTSW 2 155964111 missense probably damaging 1.00
R0973:Cep250 UTSW 2 155964289 splice site probably benign
R1137:Cep250 UTSW 2 155990840 missense probably benign 0.05
R1270:Cep250 UTSW 2 155990681 missense probably benign 0.01
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1703:Cep250 UTSW 2 155965546 missense probably benign 0.23
R1705:Cep250 UTSW 2 155963786 missense probably damaging 1.00
R1740:Cep250 UTSW 2 155973356 missense probably damaging 0.99
R1796:Cep250 UTSW 2 155992187 missense possibly damaging 0.88
R1897:Cep250 UTSW 2 155976095 missense probably damaging 1.00
R1900:Cep250 UTSW 2 155985374 critical splice donor site probably null
R1958:Cep250 UTSW 2 155976381 splice site probably null
R1974:Cep250 UTSW 2 155989504 missense probably damaging 0.96
R2015:Cep250 UTSW 2 155981453 missense probably damaging 0.96
R2033:Cep250 UTSW 2 155970892 missense probably damaging 0.99
R2224:Cep250 UTSW 2 155991817 missense possibly damaging 0.94
R2266:Cep250 UTSW 2 155976170 missense probably benign 0.13
R2278:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2332:Cep250 UTSW 2 155990607 missense probably damaging 1.00
R2364:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2366:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2367:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2385:Cep250 UTSW 2 155974341 missense probably damaging 1.00
R2830:Cep250 UTSW 2 155983316 missense probably benign 0.00
R2895:Cep250 UTSW 2 155992122 missense probably benign 0.00
R2965:Cep250 UTSW 2 155994878 missense probably benign 0.44
R2966:Cep250 UTSW 2 155994878 missense probably benign 0.44
R3016:Cep250 UTSW 2 155991288 missense probably damaging 1.00
R3052:Cep250 UTSW 2 155991048 missense probably damaging 0.99
R3424:Cep250 UTSW 2 155981461 missense probably benign 0.02
R3930:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4085:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4087:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4088:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4090:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4110:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4355:Cep250 UTSW 2 155991525 missense probably damaging 1.00
R4601:Cep250 UTSW 2 155962053 missense probably benign 0.10
R4721:Cep250 UTSW 2 155970199 missense probably damaging 1.00
R4995:Cep250 UTSW 2 155988316 missense probably damaging 1.00
R5053:Cep250 UTSW 2 155962928 missense possibly damaging 0.77
R5090:Cep250 UTSW 2 155976404 missense probably damaging 1.00
R5744:Cep250 UTSW 2 155981474 missense possibly damaging 0.60
R5775:Cep250 UTSW 2 155969374 missense possibly damaging 0.92
R5986:Cep250 UTSW 2 155979277 missense probably damaging 1.00
R6112:Cep250 UTSW 2 155994583 missense possibly damaging 0.95
R6152:Cep250 UTSW 2 155981438 missense possibly damaging 0.94
R6823:Cep250 UTSW 2 155981459 missense probably benign 0.02
R6859:Cep250 UTSW 2 155992526 missense probably benign 0.24
R6900:Cep250 UTSW 2 155996270 critical splice acceptor site probably null
R7107:Cep250 UTSW 2 155995394 missense probably benign 0.00
R7178:Cep250 UTSW 2 155973455 nonsense probably null
R7241:Cep250 UTSW 2 155991552 missense probably benign 0.20
R7264:Cep250 UTSW 2 155979151 missense probably damaging 0.99
R7290:Cep250 UTSW 2 155992762 missense probably benign 0.03
X0061:Cep250 UTSW 2 155961985 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAGCCATGAGGAATCCAAG -3'
(R):5'- AGGTCTCTGAGCACAGGAAG -3'

Sequencing Primer
(F):5'- CCATGAGGAATCCAAGACTCTTGTG -3'
(R):5'- TTGGCCACAAAACCCAAGGTG -3'
Posted On2019-05-15