Incidental Mutation 'R7131:Spg20'
ID552627
Institutional Source Beutler Lab
Gene Symbol Spg20
Ensembl Gene ENSMUSG00000036580
Gene Namespastic paraplegia 20, spartin (Troyer syndrome) homolog (human)
SynonymsTAHCCP1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7131 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location55112108-55137322 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 55121799 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000107971] [ENSMUST00000117341] [ENSMUST00000118118] [ENSMUST00000146109] [ENSMUST00000149767]
Predicted Effect probably null
Transcript: ENSMUST00000044116
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107971
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117341
SMART Domains Protein: ENSMUSP00000113968
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 582 9.3e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118118
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146109
SMART Domains Protein: ENSMUSP00000121683
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149767
SMART Domains Protein: ENSMUSP00000119719
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 92 6.83e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lipid droplet amintenance, cytokinesis and impaired motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,548,956 V435A possibly damaging Het
Abca13 A G 11: 9,291,893 N1252S probably benign Het
Abcc3 A T 11: 94,365,031 F543I probably damaging Het
Adam15 T A 3: 89,346,980 Q170L possibly damaging Het
AF366264 A T 8: 13,836,982 W370R probably damaging Het
Aldoc A G 11: 78,324,456 I19V possibly damaging Het
Atrip T C 9: 109,060,420 I711M probably benign Het
Brwd1 A C 16: 96,066,498 L149R probably damaging Het
Capn9 A T 8: 124,576,278 D45V probably damaging Het
Card9 G A 2: 26,358,835 R101C probably damaging Het
Casc1 A T 6: 145,177,406 L578Q probably null Het
Ccdc36 A T 9: 108,417,420 D98E probably benign Het
Ccdc87 A G 19: 4,841,757 E759G probably damaging Het
Cep250 T C 2: 155,965,077 M193T probably damaging Het
Cfap54 T C 10: 92,821,104 K3029E probably benign Het
Chrna9 G A 5: 65,977,141 G445D possibly damaging Het
Cluap1 C T 16: 3,940,775 S367L probably benign Het
Col5a1 A G 2: 27,929,486 D200G unknown Het
Crhr2 T C 6: 55,092,127 N388D Het
Cyp2b23 A G 7: 26,681,413 L129P probably benign Het
Cyr61 T C 3: 145,648,781 D125G probably damaging Het
Dctd A G 8: 48,112,040 S67G probably benign Het
Dhtkd1 C G 2: 5,904,070 V738L probably benign Het
Dnah17 C T 11: 118,079,658 D2173N probably benign Het
Dnah7c G T 1: 46,681,772 A2819S probably benign Het
Dot1l A G 10: 80,792,341 H1071R unknown Het
Doxl2 T A 6: 48,976,372 Y410* probably null Het
Dync2h1 T A 9: 7,075,786 D3027V probably damaging Het
Efl1 A G 7: 82,658,064 Y56C probably damaging Het
Eif4e1b A T 13: 54,784,100 R29W probably null Het
Evc2 A G 5: 37,410,258 R860G probably damaging Het
Fbxl12 G A 9: 20,644,383 probably benign Het
Fibp T A 19: 5,461,491 I129N probably damaging Het
Folh1 G T 7: 86,726,112 H555Q probably damaging Het
Gcnt4 A T 13: 96,946,519 T108S probably damaging Het
Gm436 A G 4: 144,670,067 V365A probably damaging Het
H1fnt T A 15: 98,256,369 K300* probably null Het
Hecw2 A T 1: 53,865,121 V1156E probably damaging Het
Herc3 C G 6: 58,887,424 A681G probably damaging Het
Igkv13-84 T A 6: 68,939,780 C20* probably null Het
Ivd C A 2: 118,869,774 T94K probably damaging Het
Kank2 C T 9: 21,794,679 A348T probably benign Het
Kcnma1 T C 14: 23,367,494 Y889C probably damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,849,616 probably benign Het
Kmt5b T A 19: 3,815,412 D825E probably benign Het
Krt39 C T 11: 99,520,871 A130T probably benign Het
Krtap4-9 C T 11: 99,785,457 T68I unknown Het
Lmbr1l A T 15: 98,906,323 V365E probably benign Het
Lonp1 C T 17: 56,617,814 R531Q probably damaging Het
Mecom T A 3: 29,980,945 H194L probably damaging Het
Mlx C T 11: 101,089,242 H188Y probably damaging Het
Mrps10 T C 17: 47,375,015 S77P probably damaging Het
Mst1 A G 9: 108,084,931 E716G probably null Het
Mttp C T 3: 138,116,132 V210I probably benign Het
Mug2 T C 6: 122,075,247 V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 M1T probably null Het
Neurog1 A T 13: 56,251,750 N61K probably benign Het
Nlrp14 A G 7: 107,184,814 D581G possibly damaging Het
Nlrp4a C A 7: 26,449,833 N288K probably benign Het
Notch3 T A 17: 32,144,217 H1264L probably benign Het
Olfr384 A T 11: 73,602,736 D52V possibly damaging Het
Olfr394 A T 11: 73,887,954 C139* probably null Het
Olfr402 A G 11: 74,155,780 M209V probably benign Het
Patl2 A T 2: 122,121,782 probably null Het
Pfkfb4 A G 9: 109,007,302 T133A probably benign Het
Pla2g4f T C 2: 120,304,554 E471G probably null Het
Postn T C 3: 54,362,635 V45A probably damaging Het
Ppan T A 9: 20,891,154 V257E possibly damaging Het
Ptcra C G 17: 46,763,596 A7P probably damaging Het
Ptprd C T 4: 76,066,340 R523H probably damaging Het
Pycrl A T 15: 75,918,695 I105N possibly damaging Het
Rfx1 C A 8: 84,095,079 Q815K probably damaging Het
Rfx3 T A 19: 27,768,628 K668* probably null Het
Ryr2 A T 13: 11,640,327 D3661E possibly damaging Het
Ryr2 A G 13: 11,668,811 probably null Het
Sec23ip T A 7: 128,779,640 S974T probably damaging Het
Setbp1 A G 18: 79,086,960 F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,796,418 probably benign Het
Sh3pxd2b A G 11: 32,422,072 K413R probably damaging Het
Slc39a12 T C 2: 14,449,803 V544A probably damaging Het
Slc6a7 T C 18: 61,002,202 Y418C probably damaging Het
Snx19 T G 9: 30,427,893 I109S probably damaging Het
Sptbn2 A T 19: 4,749,460 Q2097L probably null Het
Syne1 T C 10: 5,228,221 K4751R probably damaging Het
Tigit C A 16: 43,662,252 G40C probably damaging Het
Tmem181a T A 17: 6,297,972 I264K probably damaging Het
Tom1 T A 8: 75,057,249 I287N possibly damaging Het
Top2a G A 11: 99,004,182 P864L possibly damaging Het
Trmt44 A T 5: 35,571,066 V290E probably damaging Het
Try4 T C 6: 41,304,403 I93T probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Uspl1 A T 5: 149,193,935 R109S probably benign Het
Vav3 T A 3: 109,664,346 F755I probably damaging Het
Vezt A T 10: 93,970,547 Y667* probably null Het
Vmn1r231 T A 17: 20,889,878 L258F possibly damaging Het
Zfp207 T C 11: 80,395,528 M489T unknown Het
Zfp462 A G 4: 55,009,380 T449A probably benign Het
Zfp956 C A 6: 47,955,847 Q19K probably benign Het
Zkscan8 A T 13: 21,525,273 W152R probably damaging Het
Other mutations in Spg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Spg20 APN 3 55121756 missense probably damaging 1.00
IGL01539:Spg20 APN 3 55117302 missense possibly damaging 0.95
IGL01982:Spg20 APN 3 55128490 splice site probably null
IGL02345:Spg20 APN 3 55117726 unclassified probably null
IGL03217:Spg20 APN 3 55128491 splice site probably benign
IGL03344:Spg20 APN 3 55121685 missense probably benign 0.03
R0145:Spg20 UTSW 3 55127671 nonsense probably null
R0522:Spg20 UTSW 3 55128365 missense probably damaging 1.00
R1506:Spg20 UTSW 3 55117571 missense probably damaging 0.99
R2043:Spg20 UTSW 3 55127548 missense probably damaging 1.00
R2183:Spg20 UTSW 3 55117133 missense probably benign 0.43
R4022:Spg20 UTSW 3 55117736 missense probably damaging 1.00
R5154:Spg20 UTSW 3 55117329 missense probably damaging 1.00
R5869:Spg20 UTSW 3 55135510 missense probably benign 0.00
R5987:Spg20 UTSW 3 55126541 missense probably benign 0.00
R6142:Spg20 UTSW 3 55117248 missense probably damaging 1.00
R6185:Spg20 UTSW 3 55117219 missense probably damaging 1.00
R6652:Spg20 UTSW 3 55124827 missense probably benign 0.00
R6791:Spg20 UTSW 3 55127561 missense probably damaging 1.00
X0018:Spg20 UTSW 3 55135499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGTGTGTGACTGGTTATACC -3'
(R):5'- AGGCAGAGCTGGTCAGTAAC -3'

Sequencing Primer
(F):5'- GGTTATACCCTCTAGTTCCTGATAGG -3'
(R):5'- CTGGTCAGTAACAGCTGAGATTAATG -3'
Posted On2019-05-15