Incidental Mutation 'R7131:Cyr61'
ID552631
Institutional Source Beutler Lab
Gene Symbol Cyr61
Ensembl Gene ENSMUSG00000028195
Gene Namecysteine rich protein 61
SynonymsCCN1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R7131 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location145646976-145649981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145648781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 125 (D125G)
Ref Sequence ENSEMBL: ENSMUSP00000029846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029846]
Predicted Effect probably damaging
Transcript: ENSMUST00000029846
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029846
Gene: ENSMUSG00000028195
AA Change: D125G

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
IB 24 93 1.16e-24 SMART
VWC 100 163 9.94e-23 SMART
low complexity region 164 184 N/A INTRINSIC
TSP1 229 271 1.34e-5 SMART
CT 289 358 3.74e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]
PHENOTYPE: Targeted null mice die pre- or perinatally, and none survive beyond 24 hrs of birth. About 30% of embryos die by E10.5 from defects in chorioallantoic fusion, whereas 70% die from placental vascular defects, including impaired allantoic vessel bifurcation, and loss of large-vessel integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,548,956 V435A possibly damaging Het
Abca13 A G 11: 9,291,893 N1252S probably benign Het
Abcc3 A T 11: 94,365,031 F543I probably damaging Het
Adam15 T A 3: 89,346,980 Q170L possibly damaging Het
AF366264 A T 8: 13,836,982 W370R probably damaging Het
Aldoc A G 11: 78,324,456 I19V possibly damaging Het
Atrip T C 9: 109,060,420 I711M probably benign Het
Brwd1 A C 16: 96,066,498 L149R probably damaging Het
Capn9 A T 8: 124,576,278 D45V probably damaging Het
Card9 G A 2: 26,358,835 R101C probably damaging Het
Casc1 A T 6: 145,177,406 L578Q probably null Het
Ccdc36 A T 9: 108,417,420 D98E probably benign Het
Ccdc87 A G 19: 4,841,757 E759G probably damaging Het
Cep250 T C 2: 155,965,077 M193T probably damaging Het
Cfap54 T C 10: 92,821,104 K3029E probably benign Het
Chrna9 G A 5: 65,977,141 G445D possibly damaging Het
Cluap1 C T 16: 3,940,775 S367L probably benign Het
Col5a1 A G 2: 27,929,486 D200G unknown Het
Crhr2 T C 6: 55,092,127 N388D Het
Cyp2b23 A G 7: 26,681,413 L129P probably benign Het
Dctd A G 8: 48,112,040 S67G probably benign Het
Dhtkd1 C G 2: 5,904,070 V738L probably benign Het
Dnah17 C T 11: 118,079,658 D2173N probably benign Het
Dnah7c G T 1: 46,681,772 A2819S probably benign Het
Dot1l A G 10: 80,792,341 H1071R unknown Het
Doxl2 T A 6: 48,976,372 Y410* probably null Het
Dync2h1 T A 9: 7,075,786 D3027V probably damaging Het
Efl1 A G 7: 82,658,064 Y56C probably damaging Het
Eif4e1b A T 13: 54,784,100 R29W probably null Het
Evc2 A G 5: 37,410,258 R860G probably damaging Het
Fbxl12 G A 9: 20,644,383 probably benign Het
Fibp T A 19: 5,461,491 I129N probably damaging Het
Folh1 G T 7: 86,726,112 H555Q probably damaging Het
Gcnt4 A T 13: 96,946,519 T108S probably damaging Het
Gm436 A G 4: 144,670,067 V365A probably damaging Het
H1fnt T A 15: 98,256,369 K300* probably null Het
Hecw2 A T 1: 53,865,121 V1156E probably damaging Het
Herc3 C G 6: 58,887,424 A681G probably damaging Het
Igkv13-84 T A 6: 68,939,780 C20* probably null Het
Ivd C A 2: 118,869,774 T94K probably damaging Het
Kank2 C T 9: 21,794,679 A348T probably benign Het
Kcnma1 T C 14: 23,367,494 Y889C probably damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kmt2d GCTGCTGCT GCTGCTGCTCCTGCTGCT 15: 98,849,616 probably benign Het
Kmt5b T A 19: 3,815,412 D825E probably benign Het
Krt39 C T 11: 99,520,871 A130T probably benign Het
Krtap4-9 C T 11: 99,785,457 T68I unknown Het
Lmbr1l A T 15: 98,906,323 V365E probably benign Het
Lonp1 C T 17: 56,617,814 R531Q probably damaging Het
Mecom T A 3: 29,980,945 H194L probably damaging Het
Mlx C T 11: 101,089,242 H188Y probably damaging Het
Mrps10 T C 17: 47,375,015 S77P probably damaging Het
Mst1 A G 9: 108,084,931 E716G probably null Het
Mttp C T 3: 138,116,132 V210I probably benign Het
Mug2 T C 6: 122,075,247 V988A probably damaging Het
Ndufb6 A G 4: 40,279,336 M1T probably null Het
Neurog1 A T 13: 56,251,750 N61K probably benign Het
Nlrp14 A G 7: 107,184,814 D581G possibly damaging Het
Nlrp4a C A 7: 26,449,833 N288K probably benign Het
Notch3 T A 17: 32,144,217 H1264L probably benign Het
Olfr384 A T 11: 73,602,736 D52V possibly damaging Het
Olfr394 A T 11: 73,887,954 C139* probably null Het
Olfr402 A G 11: 74,155,780 M209V probably benign Het
Patl2 A T 2: 122,121,782 probably null Het
Pfkfb4 A G 9: 109,007,302 T133A probably benign Het
Pla2g4f T C 2: 120,304,554 E471G probably null Het
Postn T C 3: 54,362,635 V45A probably damaging Het
Ppan T A 9: 20,891,154 V257E possibly damaging Het
Ptcra C G 17: 46,763,596 A7P probably damaging Het
Ptprd C T 4: 76,066,340 R523H probably damaging Het
Pycrl A T 15: 75,918,695 I105N possibly damaging Het
Rfx1 C A 8: 84,095,079 Q815K probably damaging Het
Rfx3 T A 19: 27,768,628 K668* probably null Het
Ryr2 A T 13: 11,640,327 D3661E possibly damaging Het
Ryr2 A G 13: 11,668,811 probably null Het
Sec23ip T A 7: 128,779,640 S974T probably damaging Het
Setbp1 A G 18: 79,086,960 F19S probably benign Het
Setd1a AAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAG 7: 127,796,418 probably benign Het
Sh3pxd2b A G 11: 32,422,072 K413R probably damaging Het
Slc39a12 T C 2: 14,449,803 V544A probably damaging Het
Slc6a7 T C 18: 61,002,202 Y418C probably damaging Het
Snx19 T G 9: 30,427,893 I109S probably damaging Het
Spg20 T C 3: 55,121,799 probably null Het
Sptbn2 A T 19: 4,749,460 Q2097L probably null Het
Syne1 T C 10: 5,228,221 K4751R probably damaging Het
Tigit C A 16: 43,662,252 G40C probably damaging Het
Tmem181a T A 17: 6,297,972 I264K probably damaging Het
Tom1 T A 8: 75,057,249 I287N possibly damaging Het
Top2a G A 11: 99,004,182 P864L possibly damaging Het
Trmt44 A T 5: 35,571,066 V290E probably damaging Het
Try4 T C 6: 41,304,403 I93T probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Uspl1 A T 5: 149,193,935 R109S probably benign Het
Vav3 T A 3: 109,664,346 F755I probably damaging Het
Vezt A T 10: 93,970,547 Y667* probably null Het
Vmn1r231 T A 17: 20,889,878 L258F possibly damaging Het
Zfp207 T C 11: 80,395,528 M489T unknown Het
Zfp462 A G 4: 55,009,380 T449A probably benign Het
Zfp956 C A 6: 47,955,847 Q19K probably benign Het
Zkscan8 A T 13: 21,525,273 W152R probably damaging Het
Other mutations in Cyr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cyr61 APN 3 145648610 missense probably damaging 0.96
IGL02500:Cyr61 APN 3 145648700 missense probably damaging 1.00
IGL02963:Cyr61 APN 3 145647875 missense probably damaging 1.00
IGL03170:Cyr61 APN 3 145649759 missense probably benign 0.01
R0018:Cyr61 UTSW 3 145649431 missense probably damaging 0.99
R0846:Cyr61 UTSW 3 145647770 missense possibly damaging 0.94
R0964:Cyr61 UTSW 3 145647748 missense probably damaging 1.00
R1234:Cyr61 UTSW 3 145649839 start gained probably benign
R1968:Cyr61 UTSW 3 145648210 missense probably damaging 0.99
R1989:Cyr61 UTSW 3 145647743 missense probably benign 0.31
R2071:Cyr61 UTSW 3 145648673 nonsense probably null
R5622:Cyr61 UTSW 3 145649320 missense probably damaging 1.00
R5639:Cyr61 UTSW 3 145648697 missense probably damaging 1.00
R5734:Cyr61 UTSW 3 145648268 missense probably damaging 1.00
R5792:Cyr61 UTSW 3 145648658 missense probably benign
R6129:Cyr61 UTSW 3 145649231 missense possibly damaging 0.85
R6689:Cyr61 UTSW 3 145647788 missense probably benign
R7289:Cyr61 UTSW 3 145648673 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAACTCCACCTCCGAGGCATC -3'
(R):5'- GGGGAACTGTAGGGAACTTTAC -3'

Sequencing Primer
(F):5'- TCGAGTCCGAGGAGGTCATC -3'
(R):5'- GGAACTGTAGGGAACTTTACCATAC -3'
Posted On2019-05-15