Incidental Mutation 'R7132:Stip1'
ID552785
Institutional Source Beutler Lab
Gene Symbol Stip1
Ensembl Gene ENSMUSG00000024966
Gene Namestress-induced phosphoprotein 1
SynonymsHop, IEF SSP 3521, Hsp70/Hsp90 organizing protein, STI1, p60
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7132 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location7020696-7040026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7021810 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 467 (G467S)
Ref Sequence ENSEMBL: ENSMUSP00000025918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025918] [ENSMUST00000040772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025918
AA Change: G467S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025918
Gene: ENSMUSG00000024966
AA Change: G467S

DomainStartEndE-ValueType
TPR 4 37 3.07e-5 SMART
TPR 38 71 1.63e0 SMART
TPR 72 105 5.87e-2 SMART
STI1 130 169 4.84e-1 SMART
low complexity region 192 220 N/A INTRINSIC
TPR 225 258 7.45e-4 SMART
TPR 259 292 1.1e-1 SMART
TPR 300 333 1.09e-5 SMART
TPR 360 393 1.07e-4 SMART
TPR 394 427 9.45e-6 SMART
TPR 428 461 3.29e-5 SMART
STI1 492 531 1.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040772
SMART Domains Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965

DomainStartEndE-ValueType
Blast:B41 14 77 6e-32 BLAST
B41 94 556 1.66e-28 SMART
PH 350 455 2.26e-12 SMART
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] STIP1 is an adaptor protein that coordinates the functions of HSP70 (see HSPA1A; MIM 140550) and HSP90 (see HSP90AA1; MIM 140571) in protein folding. It is thought to assist in the transfer of proteins from HSP70 to HSP90 by binding both HSP90 and substrate-bound HSP70. STIP1 also stimulates the ATPase activity of HSP70 and inhibits the ATPase activity of HSP90, suggesting that it regulates both the conformations and ATPase cycles of these chaperones (Song and Masison, 2005 [PubMed 16100115]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality by E10.5, actute inflammation in the placental labyrinth, poorly formed neural tube and limb buds and increase double-strand breaks. Mice heterozygous for this allele exhibit susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C T 10: 69,989,914 A1471V Het
Ankrd12 C A 17: 65,983,247 M1730I probably benign Het
Ap2a2 T C 7: 141,619,565 Y462H probably benign Het
Ap5b1 T A 19: 5,569,384 Y277* probably null Het
App T C 16: 85,056,482 D236G unknown Het
Arid2 A T 15: 96,350,013 K102I possibly damaging Het
Asl A G 5: 130,014,702 V211A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cbx2 A G 11: 119,023,121 S5G probably benign Het
Ccdc183 A G 2: 25,616,530 probably null Het
Cd72 T C 4: 43,452,444 Q183R possibly damaging Het
Cdh26 T A 2: 178,486,762 D702E possibly damaging Het
Cfap61 A T 2: 146,109,950 N784I probably damaging Het
Cgrrf1 G A 14: 46,853,864 V282M probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cobll1 T G 2: 65,133,768 K170Q probably damaging Het
Copg2 A T 6: 30,815,996 V468D probably benign Het
Cracr2b C T 7: 141,463,738 A84V probably benign Het
Cyp2f2 A T 7: 27,132,568 D416V probably benign Het
Dcaf10 T C 4: 45,342,391 F75S probably benign Het
Eml3 G T 19: 8,941,028 A829S probably benign Het
Entpd3 A G 9: 120,561,020 T402A probably benign Het
Fer1l4 A T 2: 156,045,626 V550E probably damaging Het
Fgb G A 3: 83,046,746 R62* probably null Het
Fubp1 T A 3: 152,232,024 probably null Het
Gdf3 A C 6: 122,606,324 D361E probably damaging Het
Gm6685 A T 11: 28,339,330 I162N probably damaging Het
Hmx2 A G 7: 131,555,916 Y253C probably damaging Het
Ints2 G T 11: 86,217,754 N922K probably benign Het
Ipo7 C T 7: 110,054,047 L984F probably benign Het
Itgae A T 11: 73,111,358 Y96F possibly damaging Het
Kalrn A G 16: 34,256,227 V697A unknown Het
Kctd18 G A 1: 57,967,578 R38* probably null Het
Kdm5b A G 1: 134,599,106 D322G probably damaging Het
Ldb3 A G 14: 34,577,035 Y211H probably benign Het
Limch1 T C 5: 66,953,685 F85S probably damaging Het
Lrrn4 A T 2: 132,879,693 L68* probably null Het
Lrwd1 A G 5: 136,123,275 V616A possibly damaging Het
Nars A G 18: 64,507,770 probably null Het
Nradd T C 9: 110,622,261 D13G probably benign Het
Oacyl A T 18: 65,698,409 N39I probably damaging Het
Olfr1499 T A 19: 13,815,422 Q56L probably benign Het
Onecut2 A T 18: 64,340,912 H178L possibly damaging Het
Pcdhga4 A C 18: 37,687,377 T660P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm3 T A 11: 72,051,276 I902F possibly damaging Het
Plod3 T C 5: 136,995,117 L180S Het
Prrc2c A T 1: 162,681,281 H2354Q possibly damaging Het
Pth2r A G 1: 65,322,066 E58G probably benign Het
Rev1 G T 1: 38,071,449 D573E possibly damaging Het
Sec24a A T 11: 51,715,136 L696* probably null Het
Serpinb3c A G 1: 107,276,951 S22P probably damaging Het
St18 A T 1: 6,859,127 H81L Het
Stard9 A T 2: 120,679,378 K266* probably null Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Tcp10a C T 17: 7,344,952 T381I probably benign Het
Tecpr2 T A 12: 110,915,372 V125D probably damaging Het
Tmc2 T C 2: 130,232,409 S341P possibly damaging Het
Tmem190 G A 7: 4,784,225 V143I probably benign Het
Trap1 A G 16: 4,055,829 Y288H probably benign Het
Trim39 T C 17: 36,260,655 T404A probably benign Het
Ttn T A 2: 76,745,699 K24950I probably damaging Het
Ttn G T 2: 76,944,352 N2161K unknown Het
Unc13b T C 4: 43,215,757 S19P probably benign Het
Uqcrc1 T A 9: 108,949,468 I471N probably damaging Het
Wbp11 T C 6: 136,821,542 T170A probably benign Het
Wnk4 A G 11: 101,261,200 I177V probably benign Het
Zfp455 C A 13: 67,199,166 P51T probably damaging Het
Zfp946 T C 17: 22,454,663 Y133H probably benign Het
Zfp955a A T 17: 33,241,615 Y514* probably null Het
Zzef1 T C 11: 72,917,871 probably null Het
Other mutations in Stip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Stip1 APN 19 7021096 unclassified probably benign
IGL02506:Stip1 APN 19 7035489 splice site probably benign
IGL02515:Stip1 APN 19 7022119 missense probably benign 0.23
IGL03009:Stip1 APN 19 7021121 missense probably damaging 1.00
R1768:Stip1 UTSW 19 7021797 missense probably damaging 1.00
R3081:Stip1 UTSW 19 7035648 missense probably benign 0.42
R4530:Stip1 UTSW 19 7035658 missense probably benign 0.04
R4965:Stip1 UTSW 19 7035570 missense probably benign 0.41
R5638:Stip1 UTSW 19 7032515 missense probably damaging 1.00
R5776:Stip1 UTSW 19 7022025 critical splice donor site probably null
R5840:Stip1 UTSW 19 7022068 missense possibly damaging 0.86
R7064:Stip1 UTSW 19 7035557 missense probably benign 0.18
R7096:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7109:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7111:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7116:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7117:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7127:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7129:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7130:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCTCAGGCACATAACCTC -3'
(R):5'- AAGGTAAGCTGCTGTTGGCC -3'

Sequencing Primer
(F):5'- GAATGATAGAATTCCCTCTCACTTC -3'
(R):5'- AAGCTGCTGTTGGCCTATAAC -3'
Posted On2019-05-15