Incidental Mutation 'R7133:Gan'
ID552829
Institutional Source Beutler Lab
Gene Symbol Gan
Ensembl Gene ENSMUSG00000052557
Gene Namegiant axonal neuropathy
Synonymsgigaxonin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location117158135-117215997 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 117187230 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 122 (C122*)
Ref Sequence ENSEMBL: ENSMUSP00000070168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064488]
Predicted Effect probably null
Transcript: ENSMUST00000064488
AA Change: C122*
SMART Domains Protein: ENSMUSP00000070168
Gene: ENSMUSG00000052557
AA Change: C122*

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162997
AA Change: C121*
SMART Domains Protein: ENSMUSP00000124904
Gene: ENSMUSG00000052557
AA Change: C121*

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN). [provided by RefSeq, Oct 2008]
PHENOTYPE: Null homozygotes display some muscular atrophy and motor neuron degeneration with the severity of these symptoms depending on genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Gan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Gan APN 8 117193324 missense probably damaging 0.98
IGL01132:Gan APN 8 117196444 splice site probably benign
IGL01622:Gan APN 8 117187178 missense probably damaging 1.00
IGL01623:Gan APN 8 117187178 missense probably damaging 1.00
IGL03093:Gan APN 8 117183575 missense probably benign
R1534:Gan UTSW 8 117187429 missense probably benign 0.04
R1795:Gan UTSW 8 117196460 missense possibly damaging 0.57
R2027:Gan UTSW 8 117187499 critical splice donor site probably null
R2967:Gan UTSW 8 117183526 missense probably damaging 0.98
R3906:Gan UTSW 8 117194134 missense probably damaging 1.00
R4735:Gan UTSW 8 117194231 missense probably damaging 0.98
R5985:Gan UTSW 8 117195818 missense possibly damaging 0.89
R6027:Gan UTSW 8 117158295 missense probably damaging 1.00
R7002:Gan UTSW 8 117195847 missense possibly damaging 0.89
X0023:Gan UTSW 8 117190384 missense probably benign 0.01
Z31818:Gan UTSW 8 117195797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAATTGGGCATTCCTGTGGGC -3'
(R):5'- AACGTTCAGCTTCTCGAGAG -3'

Sequencing Primer
(F):5'- ATTCCTGTGGGCCAGACTACTAG -3'
(R):5'- TCGAGAGAGATCACTTCTTTGAG -3'
Posted On2019-05-15