Incidental Mutation 'R7133:Il17rb'
ID552851
Institutional Source Beutler Lab
Gene Symbol Il17rb
Ensembl Gene ENSMUSG00000015966
Gene Nameinterleukin 17 receptor B
SynonymsIL17RH1, Evi27, IL-17Rh1, IL-17ER, Il17br
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7133 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location29996135-30008896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29996871 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 418 (D418G)
Ref Sequence ENSEMBL: ENSMUSP00000016110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016110] [ENSMUST00000016115] [ENSMUST00000122205] [ENSMUST00000135888] [ENSMUST00000136726] [ENSMUST00000224797]
PDB Structure
Crystal Structure of iL-17 receptor B SEFIR domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000016110
AA Change: D418G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016110
Gene: ENSMUSG00000015966
AA Change: D418G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 175 4.3e-26 PFAM
Pfam:IL17R_fnIII_D2 176 268 1.3e-11 PFAM
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016115
SMART Domains Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
ACTIN 46 621 3.34e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122205
AA Change: D418G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113686
Gene: ENSMUSG00000015966
AA Change: D418G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDB:4HSA|F 34 276 2e-23 PDB
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 1.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135888
SMART Domains Protein: ENSMUSP00000121407
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 123 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136726
SMART Domains Protein: ENSMUSP00000117802
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
PDB:3JVF|C 13 171 5e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000224797
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are homozygous for a null allele have defects in their response to IL17A or IL17F. In addition this locus is a common site of retoviral integration in BXH2 murine myeloid leukemias and occurred at a CpG island 6 kb upstream of the Il17rb gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Il17rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Il17rb APN 14 30003680 missense probably damaging 1.00
IGL03151:Il17rb APN 14 30006853 missense probably benign 0.05
R0276:Il17rb UTSW 14 30004380 missense probably damaging 1.00
R0391:Il17rb UTSW 14 30004347 missense probably benign 0.00
R0391:Il17rb UTSW 14 30006155 unclassified probably null
R0408:Il17rb UTSW 14 29996680 missense probably benign 0.02
R2011:Il17rb UTSW 14 29996840 nonsense probably null
R2012:Il17rb UTSW 14 29996840 nonsense probably null
R2057:Il17rb UTSW 14 29997154 missense probably benign 0.01
R2227:Il17rb UTSW 14 30006081 missense probably benign 0.02
R3548:Il17rb UTSW 14 30008772 unclassified probably null
R4199:Il17rb UTSW 14 29996644 missense probably benign
R4578:Il17rb UTSW 14 30002399 missense probably damaging 0.97
R5092:Il17rb UTSW 14 30002376 missense probably benign 0.00
R5928:Il17rb UTSW 14 30004275 critical splice donor site probably null
R6280:Il17rb UTSW 14 30002971 missense probably benign 0.00
R6378:Il17rb UTSW 14 30000363 missense probably damaging 0.97
R6470:Il17rb UTSW 14 30002909 missense probably benign 0.10
R6741:Il17rb UTSW 14 30000336 missense possibly damaging 0.82
R6919:Il17rb UTSW 14 30004271 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCGTTTCTTCACTGACATGC -3'
(R):5'- CTGCAGAAGTGAGGTCATCC -3'

Sequencing Primer
(F):5'- ACTGACATGCTCTGCGTAG -3'
(R):5'- TGAGGTCATCCTTGAAAAATGGC -3'
Posted On2019-05-15