Incidental Mutation 'R7134:Napsa'
ID552911
Institutional Source Beutler Lab
Gene Symbol Napsa
Ensembl Gene ENSMUSG00000002204
Gene Namenapsin A aspartic peptidase
SynonymsKdap, NAP1, napsin, pronapsin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7134 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44572380-44586862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44585735 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 315 (T315A)
Ref Sequence ENSEMBL: ENSMUSP00000002274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000107907] [ENSMUST00000207493] [ENSMUST00000208514] [ENSMUST00000208651] [ENSMUST00000209177]
Predicted Effect probably benign
Transcript: ENSMUST00000002274
AA Change: T315A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204
AA Change: T315A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Asp 72 396 6.6e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107907
SMART Domains Protein: ENSMUSP00000103540
Gene: ENSMUSG00000062785

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 351 539 1.5e-31 PFAM
Pfam:Ion_trans_2 450 544 2.4e-11 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 729 745 N/A INTRINSIC
low complexity region 749 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207493
Predicted Effect probably benign
Transcript: ENSMUST00000208514
Predicted Effect probably benign
Transcript: ENSMUST00000208651
Predicted Effect probably benign
Transcript: ENSMUST00000209177
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,959,252 F638S possibly damaging Het
Actl6b T A 5: 137,564,500 N159K probably damaging Het
Adam6a T G 12: 113,545,035 S343A probably benign Het
Ankrd17 G A 5: 90,232,314 T2505I probably damaging Het
Ankrd17 T C 5: 90,285,523 T728A probably benign Het
Asap2 G T 12: 21,265,963 E919* probably null Het
Atp10b A T 11: 43,245,464 I1140F probably damaging Het
Cep126 A T 9: 8,103,382 V209E probably damaging Het
Cfap65 C T 1: 74,926,633 R406Q probably benign Het
Cldn1 T C 16: 26,371,626 M1V probably null Het
Cryl1 C T 14: 57,275,499 D304N probably benign Het
D3Ertd751e T C 3: 41,753,777 probably null Het
D630044L22Rik A T 17: 25,962,116 M156L probably benign Het
Ddx21 T C 10: 62,591,855 D423G possibly damaging Het
Dock2 T A 11: 34,310,363 M993L probably benign Het
Dupd1 A T 14: 21,677,061 I173N probably damaging Het
Eif4g1 C T 16: 20,681,502 A675V probably damaging Het
Eml1 C T 12: 108,506,551 S206L probably benign Het
Farp2 A C 1: 93,603,459 I560L probably benign Het
Fbn1 A T 2: 125,382,049 D593E probably benign Het
Fetub A G 16: 22,929,257 D61G possibly damaging Het
Fpgs T C 2: 32,686,629 K329E probably benign Het
Fpgt T C 3: 155,091,483 Y45C probably damaging Het
Gas2l1 A T 11: 5,061,106 C574* probably null Het
Gm13212 T A 4: 145,622,805 C271S possibly damaging Het
Gm6460 C T 5: 11,597,739 T148I possibly damaging Het
Gm9747 G T 1: 82,234,116 C12F unknown Het
H2-T23 T C 17: 36,031,817 Y143C probably damaging Het
Hhip A T 8: 79,992,513 S462T probably benign Het
Hnf1a C T 5: 114,953,387 G416R probably damaging Het
Hoxa5 C T 6: 52,204,043 C103Y probably damaging Het
Kansl3 G T 1: 36,351,767 D395E possibly damaging Het
March10 A G 11: 105,408,676 S116P probably benign Het
Med12l C T 3: 59,093,759 Q748* probably null Het
Mroh7 T A 4: 106,720,594 N296Y probably damaging Het
Mtbp T G 15: 55,558,565 D61E probably benign Het
Muc5b A T 7: 141,857,654 I1446L unknown Het
Myh15 T C 16: 49,081,342 V266A possibly damaging Het
Nap1l1 G A 10: 111,494,794 probably null Het
Nlrc5 A T 8: 94,479,722 I734F probably damaging Het
Nnt A G 13: 119,394,662 V183A probably damaging Het
Nploc4 A T 11: 120,385,788 D477E probably benign Het
Nrip3 A G 7: 109,765,488 S144P probably damaging Het
Ntng1 A T 3: 109,935,129 F109L probably benign Het
Olfr110 T A 17: 37,498,885 V78D probably damaging Het
Olfr303 G A 7: 86,395,544 probably benign Het
Olfr485 A G 7: 108,159,676 Y66H probably damaging Het
Olfr883 A G 9: 38,026,499 E231G probably benign Het
Pacsin1 G A 17: 27,702,733 D30N probably damaging Het
Pbld2 A T 10: 63,024,589 probably benign Het
Pcnx4 C T 12: 72,566,976 T565I probably damaging Het
Pdzk1 A T 3: 96,855,930 T225S probably benign Het
Phyhip T G 14: 70,467,199 I286S probably benign Het
Pkd1 T A 17: 24,594,112 Y3903N probably damaging Het
Plcb3 A T 19: 6,965,330 L222Q probably damaging Het
Plcd4 T A 1: 74,554,503 H262Q probably benign Het
Plekhh1 C T 12: 79,062,616 A474V probably benign Het
Plppr3 T C 10: 79,865,703 E435G probably damaging Het
Poln T A 5: 34,118,996 N305I possibly damaging Het
Pou3f2 T C 4: 22,486,874 T420A probably benign Het
Ppdpf T C 2: 181,187,730 Y17H probably damaging Het
Prrx2 C A 2: 30,878,473 T104K probably damaging Het
Ptprj A T 2: 90,464,478 L462H probably benign Het
Radil T C 5: 142,485,549 T991A probably damaging Het
Rbsn T C 6: 92,201,627 E147G probably damaging Het
Ror2 C T 13: 53,146,706 V35M probably benign Het
Rps6ka1 T C 4: 133,872,062 Q18R probably benign Het
Setbp1 T A 18: 78,859,519 D311V possibly damaging Het
Setd2 C T 9: 110,548,797 S560L possibly damaging Het
Slc12a5 A T 2: 164,974,958 I134F probably damaging Het
Svil A G 18: 5,116,080 D2035G probably damaging Het
Syngap1 T C 17: 26,960,011 Y665H probably damaging Het
Tbc1d9b T C 11: 50,152,692 Y547H possibly damaging Het
Tgm2 A G 2: 158,138,892 V83A probably benign Het
Tmem233 T C 5: 116,051,370 I117V probably benign Het
Tsen34 A G 7: 3,700,641 T293A probably damaging Het
Ttn A G 2: 76,878,679 V8752A unknown Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Uchl4 T C 9: 64,235,339 V34A probably damaging Het
Ugt2a2 C T 5: 87,460,576 R468H probably benign Het
Vmn2r102 A T 17: 19,677,487 T255S probably benign Het
Wdr6 T A 9: 108,573,365 N988I probably damaging Het
Wnk1 A T 6: 119,926,428 I2359N unknown Het
Ybey A G 10: 76,468,191 V59A probably benign Het
Zfp397 A G 18: 23,957,065 N142S probably benign Het
Zfy1 A T Y: 725,788 V659E probably damaging Het
Other mutations in Napsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Napsa APN 7 44581421 missense probably benign 0.00
IGL01380:Napsa APN 7 44586674 missense probably damaging 0.99
IGL01521:Napsa APN 7 44586637 missense probably damaging 1.00
IGL01630:Napsa APN 7 44586665 missense probably damaging 1.00
IGL01862:Napsa APN 7 44582493 missense probably damaging 0.99
IGL01935:Napsa APN 7 44586622 missense probably benign 0.01
IGL02421:Napsa APN 7 44585055 missense probably damaging 1.00
IGL02831:Napsa APN 7 44586760 missense probably benign
IGL03008:Napsa APN 7 44585796 missense possibly damaging 0.77
PIT4131001:Napsa UTSW 7 44581451 missense probably damaging 1.00
R0422:Napsa UTSW 7 44585106 missense probably damaging 1.00
R1542:Napsa UTSW 7 44581689 missense probably damaging 1.00
R1564:Napsa UTSW 7 44586649 missense probably damaging 1.00
R1903:Napsa UTSW 7 44581736 missense probably damaging 1.00
R1964:Napsa UTSW 7 44581685 missense probably benign 0.01
R2366:Napsa UTSW 7 44582485 missense probably damaging 1.00
R3713:Napsa UTSW 7 44581428 missense probably damaging 1.00
R5441:Napsa UTSW 7 44581393 unclassified probably benign
R5512:Napsa UTSW 7 44572616 start codon destroyed probably null 0.01
R5682:Napsa UTSW 7 44585344 missense possibly damaging 0.92
R6290:Napsa UTSW 7 44581337 missense probably benign 0.00
R7046:Napsa UTSW 7 44585085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCCTAAGGGACAGAAG -3'
(R):5'- TTCCTGCGTTGGATACCTG -3'

Sequencing Primer
(F):5'- AGCCAACATGCTTTCCAGGTG -3'
(R):5'- ATACCTGGGTCTGGTGCGTC -3'
Posted On2019-05-15