Incidental Mutation 'R7134:Cep126'
ID552918
Institutional Source Beutler Lab
Gene Symbol Cep126
Ensembl Gene ENSMUSG00000040729
Gene Namecentrosomal protein 126
SynonymsAK129341
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7134 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location8076461-8134294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8103382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 209 (V209E)
Ref Sequence ENSEMBL: ENSMUSP00000042904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037397]
Predicted Effect probably damaging
Transcript: ENSMUST00000037397
AA Change: V209E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042904
Gene: ENSMUSG00000040729
AA Change: V209E

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:K1377 100 1061 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,959,252 F638S possibly damaging Het
Actl6b T A 5: 137,564,500 N159K probably damaging Het
Adam6a T G 12: 113,545,035 S343A probably benign Het
Ankrd17 G A 5: 90,232,314 T2505I probably damaging Het
Ankrd17 T C 5: 90,285,523 T728A probably benign Het
Asap2 G T 12: 21,265,963 E919* probably null Het
Atp10b A T 11: 43,245,464 I1140F probably damaging Het
Cfap65 C T 1: 74,926,633 R406Q probably benign Het
Cldn1 T C 16: 26,371,626 M1V probably null Het
Cryl1 C T 14: 57,275,499 D304N probably benign Het
D3Ertd751e T C 3: 41,753,777 probably null Het
D630044L22Rik A T 17: 25,962,116 M156L probably benign Het
Ddx21 T C 10: 62,591,855 D423G possibly damaging Het
Dock2 T A 11: 34,310,363 M993L probably benign Het
Dupd1 A T 14: 21,677,061 I173N probably damaging Het
Eif4g1 C T 16: 20,681,502 A675V probably damaging Het
Eml1 C T 12: 108,506,551 S206L probably benign Het
Farp2 A C 1: 93,603,459 I560L probably benign Het
Fbn1 A T 2: 125,382,049 D593E probably benign Het
Fetub A G 16: 22,929,257 D61G possibly damaging Het
Fpgs T C 2: 32,686,629 K329E probably benign Het
Fpgt T C 3: 155,091,483 Y45C probably damaging Het
Gas2l1 A T 11: 5,061,106 C574* probably null Het
Gm13212 T A 4: 145,622,805 C271S possibly damaging Het
Gm6460 C T 5: 11,597,739 T148I possibly damaging Het
Gm9747 G T 1: 82,234,116 C12F unknown Het
H2-T23 T C 17: 36,031,817 Y143C probably damaging Het
Hhip A T 8: 79,992,513 S462T probably benign Het
Hnf1a C T 5: 114,953,387 G416R probably damaging Het
Hoxa5 C T 6: 52,204,043 C103Y probably damaging Het
Kansl3 G T 1: 36,351,767 D395E possibly damaging Het
March10 A G 11: 105,408,676 S116P probably benign Het
Med12l C T 3: 59,093,759 Q748* probably null Het
Mroh7 T A 4: 106,720,594 N296Y probably damaging Het
Mtbp T G 15: 55,558,565 D61E probably benign Het
Muc5b A T 7: 141,857,654 I1446L unknown Het
Myh15 T C 16: 49,081,342 V266A possibly damaging Het
Nap1l1 G A 10: 111,494,794 probably null Het
Napsa A G 7: 44,585,735 T315A probably benign Het
Nlrc5 A T 8: 94,479,722 I734F probably damaging Het
Nnt A G 13: 119,394,662 V183A probably damaging Het
Nploc4 A T 11: 120,385,788 D477E probably benign Het
Nrip3 A G 7: 109,765,488 S144P probably damaging Het
Ntng1 A T 3: 109,935,129 F109L probably benign Het
Olfr110 T A 17: 37,498,885 V78D probably damaging Het
Olfr303 G A 7: 86,395,544 probably benign Het
Olfr485 A G 7: 108,159,676 Y66H probably damaging Het
Olfr883 A G 9: 38,026,499 E231G probably benign Het
Pacsin1 G A 17: 27,702,733 D30N probably damaging Het
Pbld2 A T 10: 63,024,589 probably benign Het
Pcnx4 C T 12: 72,566,976 T565I probably damaging Het
Pdzk1 A T 3: 96,855,930 T225S probably benign Het
Phyhip T G 14: 70,467,199 I286S probably benign Het
Pkd1 T A 17: 24,594,112 Y3903N probably damaging Het
Plcb3 A T 19: 6,965,330 L222Q probably damaging Het
Plcd4 T A 1: 74,554,503 H262Q probably benign Het
Plekhh1 C T 12: 79,062,616 A474V probably benign Het
Plppr3 T C 10: 79,865,703 E435G probably damaging Het
Poln T A 5: 34,118,996 N305I possibly damaging Het
Pou3f2 T C 4: 22,486,874 T420A probably benign Het
Ppdpf T C 2: 181,187,730 Y17H probably damaging Het
Prrx2 C A 2: 30,878,473 T104K probably damaging Het
Ptprj A T 2: 90,464,478 L462H probably benign Het
Radil T C 5: 142,485,549 T991A probably damaging Het
Rbsn T C 6: 92,201,627 E147G probably damaging Het
Ror2 C T 13: 53,146,706 V35M probably benign Het
Rps6ka1 T C 4: 133,872,062 Q18R probably benign Het
Setbp1 T A 18: 78,859,519 D311V possibly damaging Het
Setd2 C T 9: 110,548,797 S560L possibly damaging Het
Slc12a5 A T 2: 164,974,958 I134F probably damaging Het
Svil A G 18: 5,116,080 D2035G probably damaging Het
Syngap1 T C 17: 26,960,011 Y665H probably damaging Het
Tbc1d9b T C 11: 50,152,692 Y547H possibly damaging Het
Tgm2 A G 2: 158,138,892 V83A probably benign Het
Tmem233 T C 5: 116,051,370 I117V probably benign Het
Tsen34 A G 7: 3,700,641 T293A probably damaging Het
Ttn A G 2: 76,878,679 V8752A unknown Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Uchl4 T C 9: 64,235,339 V34A probably damaging Het
Ugt2a2 C T 5: 87,460,576 R468H probably benign Het
Vmn2r102 A T 17: 19,677,487 T255S probably benign Het
Wdr6 T A 9: 108,573,365 N988I probably damaging Het
Wnk1 A T 6: 119,926,428 I2359N unknown Het
Ybey A G 10: 76,468,191 V59A probably benign Het
Zfp397 A G 18: 23,957,065 N142S probably benign Het
Zfy1 A T Y: 725,788 V659E probably damaging Het
Other mutations in Cep126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Cep126 APN 9 8103319 missense possibly damaging 0.57
IGL01967:Cep126 APN 9 8095208 splice site probably null
IGL02065:Cep126 APN 9 8099924 missense probably benign 0.09
IGL03215:Cep126 APN 9 8100530 nonsense probably null
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0184:Cep126 UTSW 9 8103395 missense probably benign 0.19
R0835:Cep126 UTSW 9 8130223 missense probably damaging 1.00
R0980:Cep126 UTSW 9 8100719 missense probably damaging 0.99
R1288:Cep126 UTSW 9 8112181 missense probably benign 0.01
R1341:Cep126 UTSW 9 8099776 missense possibly damaging 0.78
R1351:Cep126 UTSW 9 8100086 missense probably damaging 0.99
R1484:Cep126 UTSW 9 8100553 missense possibly damaging 0.81
R1707:Cep126 UTSW 9 8100382 missense probably benign 0.00
R1732:Cep126 UTSW 9 8099761 missense probably benign
R1903:Cep126 UTSW 9 8120747 missense possibly damaging 0.58
R1968:Cep126 UTSW 9 8100908 missense probably damaging 1.00
R2216:Cep126 UTSW 9 8120678 missense probably damaging 1.00
R2260:Cep126 UTSW 9 8101748 missense possibly damaging 0.50
R2444:Cep126 UTSW 9 8101306 missense probably damaging 1.00
R4208:Cep126 UTSW 9 8100821 missense probably damaging 1.00
R4499:Cep126 UTSW 9 8101588 missense possibly damaging 0.80
R4585:Cep126 UTSW 9 8103337 missense probably damaging 0.99
R5547:Cep126 UTSW 9 8100427 missense probably damaging 0.97
R5752:Cep126 UTSW 9 8120745 nonsense probably null
R5794:Cep126 UTSW 9 8103439 missense possibly damaging 0.64
R5932:Cep126 UTSW 9 8103508 missense probably damaging 1.00
R5956:Cep126 UTSW 9 8112119 missense probably benign 0.08
R6354:Cep126 UTSW 9 8099927 missense probably damaging 1.00
R6442:Cep126 UTSW 9 8100563 missense probably benign 0.14
R6964:Cep126 UTSW 9 8112100 missense probably null 0.99
R7161:Cep126 UTSW 9 8087399 missense not run
R7221:Cep126 UTSW 9 8100987 nonsense probably null
X0060:Cep126 UTSW 9 8087255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTGTGCTGACTCATCTGC -3'
(R):5'- TTTCTACCCCAGCCCAAGTG -3'

Sequencing Primer
(F):5'- GTAGGGCAGAATGATTACTCC -3'
(R):5'- CAAAGTCATGAATGAATGAGTGTCC -3'
Posted On2019-05-15